ID: 1043524978

View in Genome Browser
Species Human (GRCh38)
Location 8:81086742-81086764
Sequence AGCCAGGGAAATGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043524976_1043524978 -10 Left 1043524976 8:81086729-81086751 CCACCTCATTGGCAGCCAGGGAA 0: 1
1: 0
2: 3
3: 19
4: 210
Right 1043524978 8:81086742-81086764 AGCCAGGGAAATGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043524978 Original CRISPR AGCCAGGGAAATGCAAATTG AGG Intronic
No off target data available for this crispr