ID: 1043526562

View in Genome Browser
Species Human (GRCh38)
Location 8:81104089-81104111
Sequence CCTACCATGTGGAAGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043526562_1043526569 13 Left 1043526562 8:81104089-81104111 CCACCCACCTTCCACATGGTAGG 0: 1
1: 0
2: 0
3: 21
4: 206
Right 1043526569 8:81104125-81104147 TGACCAGAACCGGAAACTCTAGG No data
1043526562_1043526568 3 Left 1043526562 8:81104089-81104111 CCACCCACCTTCCACATGGTAGG 0: 1
1: 0
2: 0
3: 21
4: 206
Right 1043526568 8:81104115-81104137 TAATATTTATTGACCAGAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043526562 Original CRISPR CCTACCATGTGGAAGGTGGG TGG (reversed) Intronic
901329678 1:8396168-8396190 TCTACCATCAGGAAAGTGGGAGG + Intronic
902685364 1:18073282-18073304 CAGGCGATGTGGAAGGTGGGCGG + Intergenic
903100467 1:21024327-21024349 CCGACCGTGAGGGAGGTGGGGGG + Intronic
905272227 1:36794592-36794614 CTTTCCATGTGGCAGGTGGTAGG - Intergenic
905674468 1:39816103-39816125 CCTGCCATTTAGAAGGTGAGGGG - Intergenic
906427291 1:45724999-45725021 CCGTCCAGGTGGGAGGTGGGGGG + Intronic
907238089 1:53065006-53065028 CCAGCCATGTGGGAGGTGTGTGG - Intronic
907353495 1:53853030-53853052 GATACTATGTGGAAGGTGAGTGG + Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
908676859 1:66614740-66614762 CCTACCATGTGGAGGCAGAGAGG - Intronic
908769051 1:67579870-67579892 CTTACCATGTGGCAGGTGCTTGG - Intergenic
909638351 1:77843511-77843533 CGTACCATGTGGTAGGTGCCAGG + Intronic
909680660 1:78287810-78287832 CCTACTATGTGGAAGAAGTGGGG + Intergenic
910039442 1:82831448-82831470 TCCACCATGTGCAAGGTGAGTGG - Intergenic
910541929 1:88369305-88369327 GCTACCATGTGGAAGGAGTTAGG - Intergenic
910712650 1:90197557-90197579 CCTTCCATGGGGAAGGGGGATGG + Intergenic
911360696 1:96873018-96873040 CCTACCCTGATGAAGGTGGCAGG + Intergenic
915961629 1:160271870-160271892 CCTACCTTGAGGAAAGGGGGAGG + Intergenic
917692833 1:177486736-177486758 CCTTCCTTGTGGAAACTGGGAGG - Intergenic
918260875 1:182794899-182794921 CCTACCCTGAGGAAAGTGGGAGG + Intronic
921784383 1:219211168-219211190 CACACAATGTGGAAGGAGGGAGG - Intronic
922482160 1:225946500-225946522 CAGACCTGGTGGAAGGTGGGAGG - Intergenic
923204309 1:231742932-231742954 CCTACCCTTTTGAAGGTGAGTGG + Intronic
924932559 1:248743710-248743732 CCTAGCCAGTGGAATGTGGGAGG + Intronic
1063283684 10:4660298-4660320 GCTCCCATGTGGTAGGTGGGAGG - Intergenic
1063543854 10:6961340-6961362 ACTTCCATTTGGAAGGAGGGTGG + Intergenic
1064546628 10:16456846-16456868 TGAACCATGGGGAAGGTGGGGGG + Intronic
1065363840 10:24915784-24915806 CCCACTATTTGGAAGCTGGGAGG - Intronic
1066059908 10:31713839-31713861 CCTGTCATGTGGTAGGGGGGAGG - Intergenic
1069791420 10:71024676-71024698 CATCCCATGTGGAAGGTGGAAGG - Intergenic
1069825866 10:71254635-71254657 CCAGCCAGGAGGAAGGTGGGAGG - Intronic
1070138344 10:73715605-73715627 CCTTCCAGGAGGGAGGTGGGGGG - Intergenic
1070401326 10:76055928-76055950 CCCACCATGTGGCGAGTGGGGGG + Intronic
1071166730 10:82816161-82816183 CCCACAATGTGGCAAGTGGGAGG + Intronic
1071264770 10:83955122-83955144 CCTACTATGTGCAAGGTATGGGG - Intergenic
1072304125 10:94090527-94090549 CCTTCCTTATGGAAGGTGCGGGG + Intronic
1075282940 10:121156304-121156326 CCTCCCAGGTAGAAGATGGGAGG + Intergenic
1077088111 11:764725-764747 GGCACCATGTGGAAGGAGGGAGG - Intronic
1077248139 11:1548945-1548967 CCTTCATTCTGGAAGGTGGGCGG - Intergenic
1077825700 11:5806294-5806316 CCCACCATGAGCAAGGTGTGAGG + Intronic
1078101042 11:8330451-8330473 CCCAACCTGTGGGAGGTGGGAGG - Intergenic
1078190983 11:9092046-9092068 CTTTCCACGTGGGAGGTGGGAGG + Intronic
1078775068 11:14386234-14386256 CCTCACATGTGGAAGGGGAGAGG - Intergenic
1081064059 11:38518112-38518134 CCTACCATGTTGCAAGTGTGTGG - Intergenic
1081618242 11:44603191-44603213 CTCACCCTGAGGAAGGTGGGGGG + Intronic
1082873220 11:57962696-57962718 CATACTATGTGGCAGGTCGGGGG + Intergenic
1083118909 11:60491718-60491740 CCGTCCAGGAGGAAGGTGGGGGG + Intergenic
1083792471 11:64994758-64994780 CCGCTCATGTGGAGGGTGGGAGG + Intronic
1083869838 11:65479921-65479943 CTCTCCCTGTGGAAGGTGGGGGG + Intergenic
1085281895 11:75336380-75336402 CCTAGCATGTGGACAGTGGGAGG - Intronic
1085317755 11:75555611-75555633 GCAACCCTGGGGAAGGTGGGAGG - Intergenic
1088357755 11:108961095-108961117 CCTTCCATGTGGCAGGGAGGTGG - Intergenic
1088373254 11:109114183-109114205 CCTCCTATGTGTAAGGTGGTTGG - Intergenic
1089395430 11:118133661-118133683 CATATCAGGTGGGAGGTGGGAGG + Exonic
1089963832 11:122638936-122638958 CCTTCCCTGGGGAAGGTGTGCGG - Intergenic
1091386715 12:100627-100649 CCAACCATGTTGGAGATGGGAGG + Intronic
1091978964 12:4850310-4850332 TCGACCATGTGGATGGTGGGAGG + Intronic
1092722531 12:11455959-11455981 CCCACCATGAGGAAGGTGACTGG - Intronic
1093253701 12:16839691-16839713 CCTACTGGGTGGAGGGTGGGAGG + Intergenic
1096225038 12:49861170-49861192 CCGACCGGGAGGAAGGTGGGGGG + Intergenic
1096861411 12:54531390-54531412 CCTACCTTGAGGAAAGAGGGTGG + Intronic
1097307526 12:58085901-58085923 CTTGCTATGTGGAAGCTGGGAGG + Intergenic
1097677984 12:62623363-62623385 CCCCCCATGTTGGAGGTGGGGGG - Intergenic
1100559914 12:95737861-95737883 CCTACCATGTGGAATGTTCCTGG + Exonic
1100713004 12:97277215-97277237 ACTTCCCTGTGGCAGGTGGGTGG + Intergenic
1100873431 12:98937538-98937560 TCTTTCAAGTGGAAGGTGGGAGG - Intronic
1101161576 12:101982252-101982274 CCTACCACATGGAAGGTCTGCGG + Intronic
1101834621 12:108286638-108286660 GCTGACATGTGGAAGATGGGTGG - Intergenic
1104675148 12:130707354-130707376 CCTCCCATGGGGAGGGAGGGAGG + Intronic
1109913860 13:68953952-68953974 CCCCCCATGTGGAAGGAGGGAGG + Intergenic
1115562667 14:34597158-34597180 GTTACCATGGGGCAGGTGGGTGG - Intronic
1119904298 14:78287429-78287451 CCTACAATGTGGCAGGTAGTGGG - Intronic
1120679555 14:87463992-87464014 GCTACCATGTGAAATTTGGGTGG - Intergenic
1121517619 14:94563300-94563322 CCATACATGTGGAAGGTGGTGGG + Intronic
1124631025 15:31337248-31337270 CCTTCCACGTGTAAGGCGGGCGG - Intronic
1129254902 15:74328738-74328760 CCTGCCATGCAGCAGGTGGGAGG + Intronic
1132207652 15:99997582-99997604 CCTCCCGTCTGGCAGGTGGGTGG - Exonic
1132335127 15:101043285-101043307 CATACCTAGTGGGAGGTGGGTGG - Intronic
1134572825 16:15306254-15306276 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1134937875 16:18262124-18262146 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1135058322 16:19249643-19249665 CTTTTCATGTGGAAGGTGGAAGG + Intronic
1136648374 16:31643389-31643411 ACTTGAATGTGGAAGGTGGGAGG - Intergenic
1136918972 16:34245876-34245898 CCGTCCATGAGGGAGGTGGGTGG - Intergenic
1137684101 16:50373907-50373929 CCCACCCTGTGGGAGGTGGCTGG + Intergenic
1139088638 16:63617843-63617865 CCTCCAATGTGGCAAGTGGGTGG + Intergenic
1141800144 16:86302344-86302366 CCAAGTATGTGGATGGTGGGTGG - Intergenic
1143123036 17:4621293-4621315 GCCACCATGTGCAAGGCGGGAGG - Intergenic
1145920121 17:28604137-28604159 CCTTCCAGGAGGGAGGTGGGGGG - Intronic
1146651698 17:34611116-34611138 CCTACCAGGTGGAATGTGTGAGG + Intronic
1146945118 17:36868461-36868483 CCAACCATATGGAAGGAGCGAGG - Intergenic
1148970962 17:51481155-51481177 CCCAACATTTGGGAGGTGGGAGG - Intergenic
1149293550 17:55239888-55239910 CCTAACATGGACAAGGTGGGAGG + Intergenic
1149638484 17:58188192-58188214 TCTTCCATGTGGAAGTTGGTTGG + Intergenic
1151536784 17:74743412-74743434 CCTGCCCTGTGGAAAGCGGGTGG + Intronic
1152014200 17:77739076-77739098 GCCACCATGTGAAGGGTGGGTGG - Intergenic
1153276183 18:3369926-3369948 CCTACCATGTGTCTGGAGGGTGG + Intergenic
1153276341 18:3371591-3371613 CCTACCATGTGTCTGGAGGGTGG + Intergenic
1155354805 18:24941884-24941906 CCTACTATGTGCAAGGTGCTTGG - Intergenic
1156940722 18:42764421-42764443 TATAGCATATGGAAGGTGGGAGG - Intronic
1160439354 18:78877123-78877145 CCTGCCATGGGAGAGGTGGGTGG - Intergenic
1161165609 19:2785614-2785636 CGTAGCAGGTGGAAGGAGGGAGG + Exonic
1161742622 19:6032613-6032635 CCTGCCAAGTGGGAGTTGGGAGG - Intronic
1165006920 19:32814872-32814894 CCTCCCATGGTGAGGGTGGGGGG - Intronic
1165177890 19:33943325-33943347 CCGTGCATGTGCAAGGTGGGGGG + Intergenic
1165462427 19:35952010-35952032 GCTACCATGGGGAGGGTGGATGG + Intergenic
1166331699 19:42081481-42081503 GCTAAGAGGTGGAAGGTGGGGGG - Exonic
1166877126 19:45904045-45904067 CCTGCTGTGTGGAGGGTGGGTGG + Intergenic
1166990569 19:46690246-46690268 GCTGCCATCTGGAGGGTGGGTGG - Intronic
1168670644 19:58238709-58238731 CCTACAATGAGGGAGGTGGGAGG - Intronic
925918754 2:8625273-8625295 CCTTCCCTGTGGCAGGTGGTTGG + Intergenic
927259150 2:21069504-21069526 CCTGCCATGGGGTAGGGGGGTGG - Intergenic
927450569 2:23206043-23206065 TGGACAATGTGGAAGGTGGGTGG - Intergenic
928558047 2:32447709-32447731 CCGACCAGGAGGGAGGTGGGGGG - Intronic
929019741 2:37539773-37539795 CTTACAATTTGGAAGGTTGGTGG + Intergenic
929681421 2:43996495-43996517 CCTATCATGTTGAACCTGGGAGG - Intergenic
930734134 2:54757802-54757824 CCTACCAGGGCGAGGGTGGGAGG - Intronic
931551086 2:63447093-63447115 GATACCTTGTTGAAGGTGGGGGG + Intronic
935130541 2:100257933-100257955 CCTGGCATCTGGAAGGTGGAGGG - Intergenic
937165297 2:119808665-119808687 CCAACGATTTGGGAGGTGGGAGG - Intronic
937790768 2:125958670-125958692 TCTACCATGTAGAAGGTTGATGG + Intergenic
938374902 2:130798717-130798739 TATCACATGTGGAAGGTGGGTGG - Intergenic
939760491 2:146171381-146171403 CCTACCATTTGGATGCTGGGAGG + Intergenic
941008545 2:160271372-160271394 CCTGCCATGTGGATGGTGTGCGG - Intronic
941822327 2:169855979-169856001 CCCCCCATCTGGGAGGTGGGGGG - Intronic
946572825 2:221043149-221043171 CAGACCATGTGGAAGCTTGGTGG - Intergenic
947138750 2:227001334-227001356 CCAGCCATGTCCAAGGTGGGCGG - Intergenic
947531475 2:230911450-230911472 CCAACCATCAGGAAAGTGGGTGG - Intronic
947941374 2:234058948-234058970 ACTACTATGTGGTAAGTGGGAGG + Exonic
1169847022 20:10005042-10005064 CCTGCCATGGGGAGGGTGAGGGG + Intronic
1171395777 20:24832248-24832270 GCTGCCATGGGGAAGGTGGGAGG - Intergenic
1177827984 21:26105632-26105654 GCTACAATGTGGAAAGTGGCAGG + Intronic
1178635890 21:34302822-34302844 TCTAACATGTGGAAGGTGTTAGG + Intergenic
1181383908 22:22529289-22529311 CCAGCACTGTGGAAGGTGGGAGG - Intergenic
1182326643 22:29518366-29518388 CTTACCATGTGGCAGGGGGATGG - Intronic
1183622319 22:38981823-38981845 CCCACCTTCTGGAAGCTGGGAGG + Intronic
1183627485 22:39013722-39013744 CCCACCTTCTGGAAGCTGGGAGG + Intergenic
950254833 3:11495978-11496000 GCTACCATGTGGAAAGTGCCTGG - Intronic
950580056 3:13856074-13856096 CCTACCTTCTGCAGGGTGGGAGG - Intronic
951991898 3:28684381-28684403 CCCAGCATTTGGGAGGTGGGTGG - Intergenic
952552987 3:34500129-34500151 CCTAGCATGTGTTAGGTGAGGGG + Intergenic
953229507 3:41052144-41052166 ACTTCCAACTGGAAGGTGGGAGG + Intergenic
953405292 3:42656834-42656856 CCTGGCATGGGGAAGGGGGGCGG + Intronic
954269342 3:49495402-49495424 CCTACCCTGTGCTAGGTGTGAGG - Intronic
954481275 3:50803795-50803817 CCTTCCAGGAGGGAGGTGGGGGG - Intronic
954640064 3:52092520-52092542 GCTGCCATGTGCCAGGTGGGAGG + Intronic
962572384 3:136723962-136723984 CCGACCAGGAGGGAGGTGGGGGG + Intronic
964612036 3:158625162-158625184 CCTGCCATGAGCAAGGTGGAGGG + Intergenic
965423543 3:168493106-168493128 TCTACCATGAAGAAGGTGTGTGG + Intergenic
967853428 3:194098884-194098906 CCTTCTGTGTGCAAGGTGGGTGG - Intergenic
968596743 4:1489780-1489802 TCTACCACCTGGAAGGTGGGAGG + Intergenic
969656716 4:8503029-8503051 CCTCTCATGTGGGAGGTGAGGGG - Intergenic
970091795 4:12417556-12417578 CCTAGAAGGTGGGAGGTGGGGGG - Intergenic
970640879 4:18064658-18064680 CATACCATGGGGAAGGAAGGAGG - Intergenic
970803650 4:20004648-20004670 CCCACAATGTGGAAGGTGACCGG - Intergenic
974589485 4:63925472-63925494 CCCACCATGTGGAAGGGAGAAGG - Intergenic
978764799 4:112393057-112393079 CCTAACATGTAGAATGTGGCTGG + Intronic
979117640 4:116847906-116847928 CCTAGAGTGTGGAAGGAGGGAGG + Intergenic
979160707 4:117457267-117457289 CATGCAATGTGGAACGTGGGAGG - Intergenic
982320152 4:154068721-154068743 CCTTCCAAGTGGGAGATGGGAGG + Intergenic
983313567 4:166097413-166097435 TCTACCATTTGGAAGATGGAGGG + Intronic
985380411 4:189388958-189388980 CCTCACATGTGGCAGGTGGTGGG - Intergenic
985947542 5:3198077-3198099 CCTACCATTTGGAAAGTGCCAGG - Intergenic
990685833 5:58300084-58300106 CCTTCTATGTGGAAGGGGGTTGG - Intergenic
991408969 5:66328330-66328352 CCTCCCATGTGGAAGGCAGAAGG - Intergenic
992663789 5:78985771-78985793 CCCAGCCTGTGGCAGGTGGGAGG + Exonic
992758382 5:79930485-79930507 GCTGCCATGTGGGAGCTGGGTGG + Intergenic
993683751 5:90912532-90912554 ACTAGAATGTGGAAGGAGGGAGG - Intronic
995350959 5:111174998-111175020 GCTACCATGTGGCAGTGGGGTGG - Intergenic
995906489 5:117130371-117130393 CTTGGCAGGTGGAAGGTGGGAGG - Intergenic
996843271 5:127871826-127871848 CCTACCGGGTGGAAAGAGGGAGG - Intergenic
997385373 5:133468158-133468180 CCCACCATGGGGAAGGCTGGGGG + Intronic
997660536 5:135586196-135586218 CCTCCCAGGAGGAGGGTGGGGGG + Intergenic
997874813 5:137537936-137537958 CCGTCCAGGTGGGAGGTGGGGGG - Intronic
999740037 5:154542929-154542951 GATACCAGGTGGAAGGTGGAAGG - Intergenic
999791953 5:154948594-154948616 ACTACTTTGTGGATGGTGGGTGG + Intronic
1002429162 5:179193046-179193068 TCTCCCAAGTGGAAAGTGGGAGG - Intronic
1002457794 5:179355657-179355679 GCTGCCATGTGTCAGGTGGGTGG - Intergenic
1003927663 6:10892103-10892125 CCAGCCATGTGGAAAGTGGTGGG + Intronic
1007422435 6:41727845-41727867 GCTTCCAAGTGGCAGGTGGGTGG + Intronic
1007722406 6:43892928-43892950 TCTACCACGTGGAGGCTGGGAGG - Intergenic
1010126701 6:72440819-72440841 CCTACTTTGTGGGGGGTGGGGGG - Intergenic
1010203188 6:73300146-73300168 CCTTCCATGTAGCAGGTGTGTGG - Intronic
1011211986 6:84965062-84965084 CCCACCATGAGCAAGGTGTGGGG + Intergenic
1014006883 6:116429349-116429371 CCTACTATGTGGCAGGTGTGGGG - Intronic
1014065539 6:117120601-117120623 CAAGCCATGTGCAAGGTGGGAGG - Intergenic
1015208806 6:130672199-130672221 CCTCCCACGTTGAAGGTGGATGG - Intergenic
1016526741 6:145010195-145010217 CCTACATGGTGGAAGGTGGAAGG - Intergenic
1017264920 6:152432972-152432994 GTTACCATGTGGAGGGTGGGAGG - Intronic
1017504934 6:155059691-155059713 CCTACCATGTGCAAGGAGAGGGG - Intronic
1018047176 6:159975527-159975549 CCTACCTTGGGGCAGGTGGAAGG + Intronic
1019917776 7:4144530-4144552 CCCGCCATCTGGGAGGTGGGAGG - Intronic
1020030503 7:4929441-4929463 CCCACCTTGAGGAAGGTGGGTGG - Intronic
1020107925 7:5430768-5430790 CCTGGCATGAGGAAGGAGGGGGG + Intergenic
1024077325 7:45828420-45828442 CCTACCATGTGTCAGGCTGGCGG - Intergenic
1027753448 7:82180809-82180831 GCTAGCAGGTGGCAGGTGGGGGG + Intronic
1028990517 7:97044418-97044440 TTTCCCATGTGGAAGGTGGGGGG - Intergenic
1029448304 7:100626980-100627002 CCTAGCATGGGGAAGGGGGCTGG + Intronic
1034947002 7:155268730-155268752 CCTACCATGAGAATGGTGTGAGG - Intergenic
1036820906 8:11938579-11938601 CCTAAAATCTGGAAGGTGAGAGG + Intergenic
1037675076 8:21044134-21044156 CCAACCAGGTGGGAGGTAGGAGG - Intergenic
1037822746 8:22142964-22142986 CCCACCCTCTGCAAGGTGGGGGG - Intergenic
1043526562 8:81104089-81104111 CCTACCATGTGGAAGGTGGGTGG - Intronic
1043737639 8:83768100-83768122 CCTGCAATGTGGCAAGTGGGAGG + Intergenic
1045394623 8:101748524-101748546 CCCACCATGGGCAGGGTGGGAGG - Intronic
1047665040 8:127082319-127082341 CCTCACTTATGGAAGGTGGGAGG - Intergenic
1047805192 8:128352044-128352066 GCTACCATGTGGAAGGGGCAAGG - Intergenic
1048430014 8:134361560-134361582 CATACCATGTGGGTAGTGGGTGG - Intergenic
1048638791 8:136329446-136329468 CCAATCATGTAGCAGGTGGGTGG + Intergenic
1049024781 8:139980829-139980851 CCTAGCGCGTGGAAGGTGGGGGG - Intronic
1049152150 8:141041861-141041883 CCGACCATATGGTAGGTGTGTGG + Intergenic
1050120149 9:2299652-2299674 ACTGCCCTGTGGAAGGTTGGAGG + Intergenic
1052723404 9:32200364-32200386 CCTACCATGTGGAAGGAAGCTGG + Intergenic
1056262519 9:84862946-84862968 CCTCACATCTGGAAGGTGGTTGG + Intronic
1060085341 9:120694982-120695004 CCTAGCATGTGGTAGGTCTGTGG - Intronic
1060801077 9:126546214-126546236 CCATCCATGTGGGAGGTGGGAGG + Intergenic
1060801578 9:126548760-126548782 CCACCCATGTGGGAGGTGGGAGG - Intergenic
1061257867 9:129463281-129463303 TCTACCATGTTGATGTTGGGTGG + Intergenic
1062000032 9:134211320-134211342 CCAACCACGTGGACGGTGTGTGG + Intergenic
1062624807 9:137437959-137437981 CCTGCCAGGTGGAAGGTTAGTGG - Exonic
1185615415 X:1418974-1418996 CCTGCGACGTGGGAGGTGGGTGG - Exonic
1188601226 X:31967549-31967571 CCTATTATGTGGATGATGGGTGG + Intronic
1191923044 X:66278133-66278155 CATTCCATGTGGATGGTGGCAGG + Intergenic
1192145296 X:68678146-68678168 ACTAGCCTGGGGAAGGTGGGTGG + Intronic
1193205885 X:78746937-78746959 CTTGCCATGGGGGAGGTGGGCGG + Intergenic
1193221045 X:78927570-78927592 CATACCATGTGGAAGTTTTGGGG + Intergenic
1193988266 X:88273998-88274020 CCTATAATGTGCATGGTGGGTGG - Intergenic
1196013686 X:110915129-110915151 CATGCCATGTGGCAGGTGGTGGG + Intergenic
1200058278 X:153472741-153472763 CCTACCATGGGGGAGGGAGGGGG + Intronic