ID: 1043526610

View in Genome Browser
Species Human (GRCh38)
Location 8:81104588-81104610
Sequence AGTTTGCAGGAGAAGATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 265}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043526610_1043526614 12 Left 1043526610 8:81104588-81104610 CCTGTCATCTTCTCCTGCAAACT 0: 1
1: 0
2: 0
3: 34
4: 265
Right 1043526614 8:81104623-81104645 GTATTCATTATCATCTCCAATGG No data
1043526610_1043526615 23 Left 1043526610 8:81104588-81104610 CCTGTCATCTTCTCCTGCAAACT 0: 1
1: 0
2: 0
3: 34
4: 265
Right 1043526615 8:81104634-81104656 CATCTCCAATGGCAGCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043526610 Original CRISPR AGTTTGCAGGAGAAGATGAC AGG (reversed) Intronic
900639938 1:3683885-3683907 TGTTTCCAGGAGAAGAGGACTGG + Intronic
900753441 1:4415926-4415948 AGCCTGCAGGAGAAGAAGGCAGG + Intergenic
901774077 1:11547284-11547306 AAGTGGGAGGAGAAGATGACAGG + Intergenic
904610221 1:31721724-31721746 AGTTAGCTGGAGAGGATGATGGG - Intergenic
904846468 1:33422168-33422190 AGTTTTCTGGAGAAAGTGACAGG - Intronic
905305232 1:37013376-37013398 TGTTTGGAGGACAAGATGCCGGG - Intronic
905407025 1:37740757-37740779 GGTTTCCAAGAGAAGATGCCAGG + Intronic
905894442 1:41535912-41535934 GGATTGCAGGAGAAGTTGCCGGG - Intronic
907462658 1:54614488-54614510 AGTTTCTAGGAGATAATGACTGG + Intronic
907545718 1:55258360-55258382 AGTTTGCTGCTGAAGATGGCTGG + Intergenic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
908335762 1:63121126-63121148 AGCTTGCAGGGGAAGATGATGGG + Intergenic
908556160 1:65258412-65258434 TGTTAGCATGAAAAGATGACAGG - Intronic
909756079 1:79227564-79227586 AGTTGGGAGGAGAGGATCACAGG - Intergenic
909911387 1:81261981-81262003 AGTTTGCAGGGGAAGAGAAAGGG + Intergenic
910287929 1:85575681-85575703 AATTTCCAGGAGAAGAGGATGGG + Intronic
912107485 1:106298317-106298339 AATTGACAGGAGAGGATGACAGG - Intergenic
913307685 1:117450057-117450079 AGGTTGGAGAAGAAGAAGACAGG + Intronic
915342508 1:155184269-155184291 AGTTTGGGGGAGAAGCTGCCAGG - Exonic
916571458 1:166031416-166031438 TGATTGAAGGAGAAGATGAGTGG - Intergenic
917393935 1:174571020-174571042 AGTGTGCATGAGCAGATGAATGG + Intronic
918161545 1:181905461-181905483 AGTTTCAAGGAGAAGAGGATAGG + Intergenic
918276552 1:182958632-182958654 AGATTGCAGGATAAGATGCCAGG + Intergenic
918419553 1:184350647-184350669 AGTTTGATGGAGTAGATGAGAGG - Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
920441410 1:205983309-205983331 AGTTTGCAGGTGGAGATGGTAGG - Intronic
920624423 1:207582736-207582758 ATTTTGAAGGTGCAGATGACAGG + Intronic
921139625 1:212294840-212294862 AGTTTCCTGGAGAAAGTGACAGG + Intronic
921154510 1:212428581-212428603 AGTTTGCAGGAAAAGTAGAAAGG + Intergenic
921810191 1:219503558-219503580 AGTTTCCAGGAGAAAATGAGTGG - Intergenic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
924207889 1:241732903-241732925 AGTTTGCAGGAAGAAATGCCGGG + Intronic
1063041799 10:2348178-2348200 AGTTTGGAAGAGAAGAGGAAAGG + Intergenic
1065207765 10:23373356-23373378 AGATAGCAGGAGAAGAGGAGTGG - Intergenic
1065585192 10:27210890-27210912 AGCATGGAGGAGAAGATGGCAGG - Exonic
1065758909 10:28963607-28963629 AGTTAGCAGGAGAAGAGGCCAGG + Intergenic
1066957621 10:42188051-42188073 AGTTAACTGGAGAAGATGACCGG - Intergenic
1070216143 10:74383443-74383465 AATTTTCAGAAGAAGATGAATGG - Intronic
1073797209 10:107001404-107001426 AGTTTGCTGGTGAAGAAGCCTGG + Intronic
1073900791 10:108218007-108218029 ACTTTGCAGGAGAAGAGCAGAGG + Intergenic
1077203344 11:1325627-1325649 AGATAGCTGGAAAAGATGACTGG + Intergenic
1079478538 11:20857406-20857428 AGCTGGCAGGAGAAGGTGAGTGG + Intronic
1079991162 11:27248567-27248589 AGTCTGCAGGAGGAGTTAACTGG + Intergenic
1079996286 11:27298523-27298545 AGACTGCAGGAGAGGATCACGGG - Intergenic
1080546571 11:33324893-33324915 AATTTGCTGGGGAAGATGCCTGG - Intronic
1081187147 11:40057833-40057855 AATTTGCAGGACAAGCTGGCAGG - Intergenic
1082172779 11:49025988-49026010 AGGTTTCAAGAGAAAATGACTGG + Intergenic
1083910829 11:65708702-65708724 AGTTTGGGAGAGAAGAGGACAGG - Intergenic
1084252073 11:67907597-67907619 AGTTTGAAGGGGAAGATCAGGGG - Intergenic
1086502706 11:87469854-87469876 AGATTGCATGAGAAAATGATTGG + Intergenic
1086692993 11:89810078-89810100 AGGTTTCAAGAGAAAATGACTGG - Intergenic
1086712809 11:90029582-90029604 AGGTTTCAAGAGAAAATGACTGG + Intergenic
1088034840 11:105298748-105298770 AGTTTGGTGGAGAGGATGAATGG + Intergenic
1088864221 11:113831713-113831735 AAGCTGCAGGATAAGATGACTGG + Intronic
1089330828 11:117687969-117687991 GGTCTGCAGGAGAAGCTGCCTGG - Intronic
1089610880 11:119667971-119667993 AGTGTGCACGAGAAGGTAACAGG - Intronic
1089657400 11:119960523-119960545 AGGCAGCAGGAGAAGGTGACAGG + Intergenic
1090281930 11:125463794-125463816 ACTTGGCAGGAAAAGACGACAGG + Intronic
1090661589 11:128886122-128886144 AATTAGCAGGAGTAGGTGACTGG - Intergenic
1092744322 12:11659455-11659477 GGTTTCCAGGAGAAGATCAGAGG - Intronic
1092854010 12:12656245-12656267 TGTGTGCAGGAGAATATGAAAGG - Intergenic
1093908433 12:24719071-24719093 AGTTGGCAGGAGGAGAAAACAGG + Intergenic
1094213601 12:27918355-27918377 AGTTTGTTGGTGATGATGACTGG - Intergenic
1096017839 12:48294760-48294782 AGTCTGCAGGAGTATATGATAGG - Intergenic
1097710158 12:62909139-62909161 AGTTTGAAAGGAAAGATGACAGG - Intronic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1099332394 12:81306097-81306119 AGTATGAAGGGGAAAATGACAGG - Intronic
1099713216 12:86256023-86256045 AATTTGCAGCAGAAAATGAAAGG - Intronic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101612764 12:106306214-106306236 AGGTTAAAAGAGAAGATGACAGG - Intronic
1102456605 12:113074789-113074811 TGTTTGAAGGTGGAGATGACTGG + Intronic
1102577464 12:113865012-113865034 AATTTGGAAGAGATGATGACTGG - Intronic
1103361019 12:120353687-120353709 AGTGTGCAGGAGATGAGGACAGG - Intronic
1104589951 12:130076095-130076117 TGTTTACAGGAAAAGATGACAGG + Intergenic
1105963067 13:25359875-25359897 AGATTGCAGCAGAACAGGACAGG - Intergenic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1109854882 13:68113911-68113933 AGTTTCCATCAGCAGATGACTGG + Intergenic
1110348491 13:74477514-74477536 AGTTTTCAGAAGAAAATGAGAGG - Intergenic
1112495320 13:99899335-99899357 AGTGTGAAGGAGAAGTTGAATGG - Intergenic
1113627390 13:111856986-111857008 AGACTGCAGGAGGAGGTGACGGG - Intergenic
1113752358 13:112785133-112785155 AGTGTGCAGGAGAAGAGAATTGG + Exonic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1116379771 14:44250962-44250984 AGATTGCAGGAGAAAAAGATAGG + Intergenic
1116460053 14:45161951-45161973 ATTTTGCAGGTCAAGCTGACAGG + Intronic
1117725449 14:58668698-58668720 GGTGTGTAGGTGAAGATGACTGG + Intergenic
1119107566 14:71938866-71938888 AGTTACCTGCAGAAGATGACAGG + Intronic
1121611223 14:95282182-95282204 ATTTTGCAGGAGCAGAGGATGGG + Intronic
1122090936 14:99339989-99340011 AGCTGGCAGGAGAAGATTCCAGG + Intergenic
1124703557 15:31939484-31939506 AATTTGAAGGAGAACATGAGAGG - Intergenic
1127053624 15:55110379-55110401 AGTTTCAAGGAGAGGATGATAGG + Intergenic
1128330575 15:66753067-66753089 ATTTTGCAGGTGAAGTTGAAGGG + Intronic
1129120949 15:73396236-73396258 AGAATGCAGGACAAGATGGCAGG - Intergenic
1129239224 15:74241782-74241804 AGTTTGAAGGTGGAGCTGACAGG + Intronic
1129316839 15:74750261-74750283 AGGTTGCAGGAGCTGATGGCAGG + Exonic
1131311061 15:91290233-91290255 AGTTTAAAGGAGAAGATAAGAGG + Intronic
1131550834 15:93355481-93355503 GGAGTGCAGGAGAAGAAGACCGG + Intergenic
1131813594 15:96199683-96199705 ATTTTGCAGGCTATGATGACTGG + Intergenic
1132552257 16:558383-558405 AGTTTGCATGAGAAGAGAAGAGG - Intergenic
1134891732 16:17847028-17847050 AGTTGCATGGAGAAGATGACAGG - Intergenic
1135105636 16:19646698-19646720 AGATTGCAGTAGAATATGGCAGG - Intronic
1135791037 16:25396163-25396185 AGTTTGCTGGGAAAGGTGACTGG - Intergenic
1136856353 16:33661676-33661698 AGTGAGGAGGAGAAGATAACAGG + Intergenic
1137553531 16:49456142-49456164 CATTTGCAGGAGATGATGACAGG + Intergenic
1138231493 16:55340268-55340290 ACTTTCAAGGAGAAGAGGACAGG + Intergenic
1138439151 16:57023977-57023999 AGTTTCCAGGAGAAAAGGACTGG + Intronic
1138498546 16:57423765-57423787 ATTTTGCATGAGATGATAACGGG + Intergenic
1139259640 16:65579262-65579284 AGTTTGCATGAGAAGAACACCGG - Intergenic
1139461189 16:67123724-67123746 AGTAGGCAGAAGAAGAGGACAGG - Intronic
1140084637 16:71783910-71783932 AGATTGCAGGAGTAGAAAACTGG - Intronic
1142132718 16:88438230-88438252 AGCTTGCTGGAGAAGAGGCCCGG - Exonic
1203117937 16_KI270728v1_random:1510154-1510176 AGTGAGGAGGAGAAGATAACAGG + Intergenic
1143508234 17:7381201-7381223 AGGACGCAGGAGAAGAGGACAGG - Intronic
1143530509 17:7500510-7500532 ATTTTGGAGGCAAAGATGACAGG - Intronic
1144113061 17:12057630-12057652 AAGTTTCAGGAGAAGATGATAGG - Intronic
1145764669 17:27450146-27450168 AGTTTACAGGAGAAGAAACCAGG - Intergenic
1145999389 17:29122215-29122237 AGATTGCAGCAGAAGAGGCCTGG - Exonic
1148137855 17:45306855-45306877 AATATGCAGGAGAACATGTCGGG + Intronic
1148898230 17:50853374-50853396 GGTTTGCAGGAGAGGGGGACTGG + Intergenic
1150914635 17:69424078-69424100 ACTTTGCAGGAGATGATAACTGG - Intronic
1151477689 17:74353169-74353191 AGTTGGCAGAGGAAGATGAGTGG - Intronic
1154290278 18:13100800-13100822 AGTTAGCAGATGAAGAAGACAGG + Intronic
1155336224 18:24767973-24767995 GGATTGCAGGAGGAGAGGACAGG + Intergenic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157753154 18:50195548-50195570 AGTTTGAAGGAGAAGATCCCTGG - Intergenic
1158199316 18:54922528-54922550 AGTTACTAGGAAAAGATGACTGG + Intronic
1158701624 18:59753855-59753877 AGTCTGCAGGAGCAGATGGTGGG - Intergenic
1159791483 18:72785350-72785372 AGTTTGAAGGTGAAATTGACAGG - Intronic
1161880530 19:6947996-6948018 AGTTTCCTGGAGAAGAGGATGGG + Intergenic
1162280199 19:9690273-9690295 AGTTTGCAGGTGAACATTAAGGG + Exonic
1162283984 19:9724083-9724105 AGTTTGCAGGTGAATATTAAGGG + Intergenic
1163190345 19:15672857-15672879 AGTTTGCAGGGGAAGTTGGAGGG - Exonic
1167163750 19:47784230-47784252 AGTTTGCAGGAACAGAGGCCAGG - Intronic
1167342745 19:48925489-48925511 GGGTTTCAGGAGAGGATGACAGG + Intergenic
925274842 2:2641397-2641419 AGTGTGCAAGAGAAGAGGTCTGG - Intergenic
925531809 2:4871777-4871799 AGTTTCCTGGAGAAGAACACAGG + Intergenic
928350234 2:30545214-30545236 AGTTTGCAGGAGGAAATGATAGG + Intronic
928817126 2:35311012-35311034 AATTTGAAGGACAAAATGACTGG + Intergenic
931929050 2:67108346-67108368 AGGTTTCAGGAAAAGATGAAAGG + Intergenic
932873486 2:75427008-75427030 AGTTTTCAAGAGAAAATGATAGG + Intergenic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
933768225 2:85725557-85725579 AGTTTCCAGGTCAAGATGTCAGG - Intergenic
934305739 2:91820565-91820587 AGTTAACTGGAGAAGATGACCGG - Intergenic
934327517 2:92032177-92032199 AGTTAACTGGAGAAGATGACCGG + Intergenic
934465906 2:94262756-94262778 AGTTAACTGGAGAAGATGACCGG + Intergenic
937032382 2:118751589-118751611 AGTTTGCGGGAGCAAAAGACTGG + Intergenic
939648266 2:144729210-144729232 AGGTAACAGAAGAAGATGACAGG - Intergenic
940337885 2:152547562-152547584 GGCTTTCAGAAGAAGATGACAGG + Intronic
940384977 2:153059780-153059802 AGTTTGGAGGAGAGAATGACAGG - Intergenic
941471208 2:165889707-165889729 AGTATTCAGGAGAAGATGCATGG - Intronic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
944890249 2:204110030-204110052 AGTCTGCAGGAGAGGAAGCCTGG - Intergenic
945222234 2:207496630-207496652 AGACTGCAGGAAAAGCTGACTGG + Intergenic
946034605 2:216731785-216731807 AGTTTGGAGGAGATGATGGAAGG - Intergenic
948086615 2:235255858-235255880 GGATTGGAGGAGAGGATGACAGG + Intergenic
948469602 2:238168459-238168481 AGTTAGAAGGTGAAGGTGACTGG - Intronic
1169529045 20:6464563-6464585 AGTTTGAAGCAGGCGATGACAGG + Intergenic
1172797037 20:37547365-37547387 AGTTTGCTGGAGCAGCTCACAGG + Intergenic
1174262910 20:49310146-49310168 ATTTTGAACGTGAAGATGACAGG + Intergenic
1177298558 21:19209552-19209574 AGTTTTCAGGAGAACAAGCCAGG - Intergenic
1177298762 21:19212371-19212393 AGTTTTCAGGAGAACAAGCCAGG + Intergenic
1177918291 21:27118768-27118790 AGTTTACAGAAGAAAATGTCTGG + Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1178076867 21:29020208-29020230 AGTTTGAAGGAGATGCTGACAGG + Intergenic
1180279825 22:10683393-10683415 AGTTAACTGGAGAACATGACCGG + Intergenic
1180587041 22:16901929-16901951 AGTTAACTGGAGAAGATGACCGG + Intergenic
1180628995 22:17214263-17214285 AGTTTGTAGCAGAAGATGCGAGG - Intronic
1182144472 22:27988787-27988809 TGTTTGCAGGAGAAAGTGCCAGG - Intronic
1182569451 22:31225711-31225733 TGTGTGCAGGTGAAGATGTCTGG + Intronic
1184386734 22:44181043-44181065 AGTTTGCAGTGGAAGAAGAAGGG - Exonic
1184797582 22:46740902-46740924 GGTTTGAAGGAGAAGGTGAGTGG - Intergenic
1185139686 22:49093369-49093391 GCTTTGCAGGAGAAGTAGACAGG + Intergenic
950048769 3:9969762-9969784 ATGATGCAGGAGCAGATGACGGG - Exonic
950783132 3:15409608-15409630 TGTTTCTCGGAGAAGATGACTGG - Intronic
951249221 3:20374815-20374837 AGTTCCCAAGAGGAGATGACTGG + Intergenic
951529020 3:23681611-23681633 AGTTGACAGGGGAAGTTGACAGG - Intergenic
951802237 3:26608600-26608622 AGTTTGAAGGTAGAGATGACAGG + Intergenic
952244593 3:31573024-31573046 AGTTTGCAGGATGAGTTAACTGG + Intronic
954788001 3:53109088-53109110 AGGGTGCAGCAGAAGATGACAGG - Intronic
956361359 3:68451560-68451582 AGATGGAAGGGGAAGATGACAGG - Intronic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957094862 3:75768886-75768908 AGTGTGTGGGTGAAGATGACAGG + Intronic
957163151 3:76636341-76636363 AGTTTACAGCTAAAGATGACAGG - Intronic
958259120 3:91359001-91359023 GGTTTGCAGGAGAGGAAGAATGG + Intergenic
958544898 3:95533356-95533378 AGTTGGCAGGTGAAAATGAGAGG - Intergenic
961639595 3:128356984-128357006 TGCTTGCTGGAGAAGATGTCAGG - Intronic
965184870 3:165449931-165449953 AGTTGGCAGGTAATGATGACTGG - Intergenic
966764639 3:183449483-183449505 AGTTTCCAGGAAAAAATCACAGG + Intergenic
967467312 3:189822874-189822896 AGATTGCAGCAGAAAATGAATGG + Intronic
968222925 3:196951759-196951781 AGTCTGCTTGAGAAGCTGACGGG - Intronic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
971953674 4:33387653-33387675 AGAATGGAGGAGAATATGACTGG - Intergenic
972832600 4:42832102-42832124 AGTTTGGAACAGAAGAAGACAGG + Intergenic
974137895 4:57842268-57842290 AGTGTGGAGGAGAAGAGAACTGG + Intergenic
976016999 4:80568040-80568062 AATTTTGAGGAAAAGATGACTGG + Intronic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
978202294 4:106036242-106036264 AACTTGGTGGAGAAGATGACTGG + Intergenic
978372198 4:108040114-108040136 AGATTGCAGGTGTAGAAGACAGG + Intergenic
978474059 4:109105793-109105815 AGTTTGCAGAAGAGGATGTGGGG - Intronic
982219701 4:153114005-153114027 AGGGTGCAGGAGGAGATAACTGG - Intergenic
982967365 4:161929408-161929430 ATATTGAAGGAGAAGAAGACAGG - Intronic
984600166 4:181717319-181717341 AAATTGCAGGAGATGATCACGGG + Intergenic
985763490 5:1764209-1764231 ACATTGCAGGAGAAGACAACAGG - Intergenic
986302452 5:6489067-6489089 AGATCGGAGGAAAAGATGACAGG - Intronic
987153604 5:15065030-15065052 AGTTTGCAGGAAAGAATGATAGG - Intergenic
988152887 5:27410123-27410145 AGGTTGCATTAAAAGATGACTGG - Intergenic
990014612 5:51044553-51044575 AGTTTAGAGGAGAAGTTCACCGG + Intergenic
990084756 5:51961483-51961505 AGATTGAAAGAGTAGATGACAGG - Intergenic
992011291 5:72530346-72530368 CGATGGCAGGAGAAGATGAAGGG + Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992483410 5:77173158-77173180 GGTTGGAAGGAGGAGATGACAGG + Intergenic
994181642 5:96773778-96773800 AGAATGCAGGAAAAGATGTCAGG + Exonic
995890575 5:116946322-116946344 AATATGCAGAAGTAGATGACTGG + Intergenic
998862392 5:146457463-146457485 AGACTTCAGGAGAAGCTGACTGG + Intronic
999381898 5:151127176-151127198 ACTTTGCAGGAGGAGATGCAGGG - Intronic
999869403 5:155733394-155733416 AGTTTGCTGGACAAGATGTCTGG - Intergenic
999990577 5:157046366-157046388 AGTTAGCTGGGAAAGATGACAGG + Intronic
1000775933 5:165419773-165419795 AGGATGCAGAAGAATATGACTGG - Intergenic
1001793342 5:174480370-174480392 AGCTGGCAGGAGAGGATGGCTGG - Intergenic
1005472054 6:26171277-26171299 AGTCTGAATGAGAAGATGGCAGG + Exonic
1005713702 6:28526448-28526470 GGTTTGGAGGAGAAGCTGAGTGG + Intronic
1006763970 6:36488502-36488524 AGTTTGTGGTAGAAGCTGACTGG + Exonic
1007975802 6:46100041-46100063 TGTTTCCAGGAGAAGAAAACTGG - Intergenic
1008533242 6:52484497-52484519 ACTTAGTAGTAGAAGATGACTGG + Intronic
1008996137 6:57661590-57661612 GGTTTGCAGGAGAGGAAGAATGG - Intergenic
1009184663 6:60560369-60560391 GGTTTGCAGGAGAGGAAGAATGG - Intergenic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009909262 6:69905131-69905153 AGTTGGCAGGATAAGGTGAGTGG - Intronic
1010899944 6:81414750-81414772 ATTTGGCAGGAGAAGTTGTCAGG + Intergenic
1011645994 6:89458634-89458656 AGCTGGCAGGAGAAGATGGAAGG - Intronic
1011752341 6:90465798-90465820 AGTTGGCAAGAGAAGATGGAAGG - Intergenic
1013079700 6:106801522-106801544 ATTTTGAAGAAGAAAATGACAGG + Intergenic
1014154014 6:118090965-118090987 AGTTTGAAGGAGGAGCTGATGGG + Intronic
1014411366 6:121125810-121125832 AGATTGCAGCAGAAGAAGCCAGG + Intronic
1015514165 6:134068413-134068435 AGTTTGCAGGAGGAGCAAACAGG + Intergenic
1016214919 6:141587942-141587964 AATTTGCAGAGGAAGATGGCAGG - Intergenic
1018219225 6:161561975-161561997 AGTTTGCAGAAGATGAGGTCAGG - Intronic
1019155052 6:170033086-170033108 TGTTTGTAGGACATGATGACTGG - Intergenic
1020778601 7:12489846-12489868 AGCTGGCAGGAGAAAGTGACAGG + Intergenic
1021399976 7:20198467-20198489 AGTGGGCAAGAGAAGATGAAAGG + Intronic
1021898901 7:25263675-25263697 AGTTTCCAGGAAAACATGACTGG - Intergenic
1023355318 7:39361343-39361365 AGTTTTCAGGAGAAGAGGCAAGG + Intronic
1023644092 7:42291427-42291449 AGTTTGCAGGTGAGGATCTCTGG - Intergenic
1024288501 7:47781754-47781776 AATTTGCAGGAGAAAAAAACAGG - Intronic
1026537290 7:71249883-71249905 AGTTTGCAAGAGCAACTGACTGG - Intronic
1027146689 7:75700455-75700477 AGAAAGCAGAAGAAGATGACAGG + Intronic
1028932686 7:96430653-96430675 AGTTTGGAGGAGAAGGGGTCTGG - Intergenic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1032655718 7:133927519-133927541 AGTTTGAAGGAGTAAATGAAAGG + Intronic
1033092741 7:138402047-138402069 AGTTTGAAAGAAGAGATGACTGG - Intergenic
1036649654 8:10634249-10634271 TGTTTGCAGAAGAGGGTGACAGG - Intronic
1038220804 8:25605158-25605180 AGTTTGCAGGAAATGAGGAGGGG + Intergenic
1040418360 8:47216843-47216865 AATTTGCAGGGGAAAATAACTGG - Intergenic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1043526610 8:81104588-81104610 AGTTTGCAGGAGAAGATGACAGG - Intronic
1045569706 8:103356190-103356212 AGTTAGAAGGAAAAGGTGACAGG + Intergenic
1046041180 8:108906741-108906763 AGGTTGCAGTAGAATAAGACAGG + Intergenic
1046995403 8:120515113-120515135 ATTTTGCAGGTAAAAATGACAGG + Intronic
1048026049 8:130587846-130587868 AGGATGCAGGAGAAGCAGACAGG + Intergenic
1050082456 9:1929300-1929322 AGGTTGCAGAAGAAAATGGCTGG - Intergenic
1050434771 9:5597403-5597425 AGTTTGGAGGAGAAGACGAAAGG - Intergenic
1050768983 9:9173035-9173057 AGTCAGGAGGAAAAGATGACTGG - Intronic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1053442146 9:38125465-38125487 AGTTAGCAGGATCAGGTGACTGG - Intergenic
1053695960 9:40639533-40639555 AGTTAACTGGAGAAGATGACCGG + Intergenic
1053856748 9:42345767-42345789 AGTTTGAAGTAGAAGATTACCGG + Intergenic
1054307207 9:63438751-63438773 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054405940 9:64762743-64762765 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054439566 9:65248230-65248252 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054490841 9:65773709-65773731 AGTTAACTGGAGAAGATGACCGG - Intergenic
1055635111 9:78269373-78269395 AGATTTCAGGAGGAAATGACTGG + Intronic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056460571 9:86805942-86805964 CATTTGCAGGAAAAGATAACAGG - Intergenic
1057750504 9:97788856-97788878 AGTTTACAGCAGGAGATGTCAGG + Intergenic
1060343497 9:122797213-122797235 AGTTTGATGGAGGAGGTGACTGG - Intergenic
1060405895 9:123372992-123373014 AGTTTCCAGGATTAGATGATAGG + Intronic
1061809800 9:133155643-133155665 AGTTTGGAGGAGCAGATGAGAGG - Intronic
1061889936 9:133613546-133613568 AGTGTGCAAGAGAAGGTGAGAGG + Intergenic
1202778407 9_KI270717v1_random:13146-13168 AGTTAACTGGAGAAGATGACCGG + Intergenic
1185928291 X:4171677-4171699 GGTTTTCAGGAGAAGAAAACTGG - Intergenic
1186078735 X:5907856-5907878 TATTTGCAGGAGAAGAAGAAAGG + Intronic
1186530450 X:10290163-10290185 AGTGTGCAGGAGATGATGAGGGG - Intergenic
1186771469 X:12822134-12822156 AATTTGCAGAAACAGATGACAGG - Intronic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192712486 X:73606337-73606359 AGTTTAGAGAAGAAGATGAATGG - Intronic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1195421887 X:104684663-104684685 AACCTGCAGGAGAAGATGATTGG + Intronic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197054843 X:122105233-122105255 AGTTAACAGGAGCAGAGGACTGG - Intergenic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1199621284 X:149704059-149704081 AGTTAGCAGTGGAAGATGGCTGG - Intronic
1199754006 X:150847783-150847805 AGAATGAAGGAGAAGATGTCGGG - Intronic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1201038423 Y:9805706-9805728 TTTTTGCAGGGGAAGATGATGGG - Intergenic
1201193721 Y:11471449-11471471 AGTTAACTGGAGAAGATGACAGG + Intergenic
1201516673 Y:14825560-14825582 TGTTTGCAGGAGAGGAAGAAAGG - Intronic