ID: 1043527248

View in Genome Browser
Species Human (GRCh38)
Location 8:81111056-81111078
Sequence GCCTTAGGGCATAAAACACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043527244_1043527248 -5 Left 1043527244 8:81111038-81111060 CCAGAGCTCGTTTTATTTGCCTT 0: 1
1: 0
2: 0
3: 5
4: 173
Right 1043527248 8:81111056-81111078 GCCTTAGGGCATAAAACACCGGG No data
1043527242_1043527248 27 Left 1043527242 8:81111006-81111028 CCTACATTCTTAAAGTGTATGAA 0: 1
1: 0
2: 0
3: 20
4: 250
Right 1043527248 8:81111056-81111078 GCCTTAGGGCATAAAACACCGGG No data
1043527243_1043527248 -4 Left 1043527243 8:81111037-81111059 CCCAGAGCTCGTTTTATTTGCCT 0: 1
1: 0
2: 1
3: 15
4: 136
Right 1043527248 8:81111056-81111078 GCCTTAGGGCATAAAACACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043527248 Original CRISPR GCCTTAGGGCATAAAACACC GGG Intronic
No off target data available for this crispr