ID: 1043529618

View in Genome Browser
Species Human (GRCh38)
Location 8:81135071-81135093
Sequence TCCAGGGGAGACAAAAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043529618_1043529627 30 Left 1043529618 8:81135071-81135093 CCACCTCTTTTGTCTCCCCTGGA No data
Right 1043529627 8:81135124-81135146 ATTCTAACTTTGTACCCTCATGG No data
1043529618_1043529623 -1 Left 1043529618 8:81135071-81135093 CCACCTCTTTTGTCTCCCCTGGA No data
Right 1043529623 8:81135093-81135115 ACCTGCAACAACCTCTTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043529618 Original CRISPR TCCAGGGGAGACAAAAGAGG TGG (reversed) Intergenic
No off target data available for this crispr