ID: 1043533650

View in Genome Browser
Species Human (GRCh38)
Location 8:81176582-81176604
Sequence AAAGGGGCACAGATACAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043533650_1043533663 26 Left 1043533650 8:81176582-81176604 CCCAGCTGTATCTGTGCCCCTTT No data
Right 1043533663 8:81176631-81176653 AGGATGTGGGGAGTAGTATCTGG No data
1043533650_1043533657 6 Left 1043533650 8:81176582-81176604 CCCAGCTGTATCTGTGCCCCTTT No data
Right 1043533657 8:81176611-81176633 AGACTGGAGCCAGAGCAGCCAGG No data
1043533650_1043533664 29 Left 1043533650 8:81176582-81176604 CCCAGCTGTATCTGTGCCCCTTT No data
Right 1043533664 8:81176634-81176656 ATGTGGGGAGTAGTATCTGGAGG No data
1043533650_1043533660 14 Left 1043533650 8:81176582-81176604 CCCAGCTGTATCTGTGCCCCTTT No data
Right 1043533660 8:81176619-81176641 GCCAGAGCAGCCAGGATGTGGGG No data
1043533650_1043533659 13 Left 1043533650 8:81176582-81176604 CCCAGCTGTATCTGTGCCCCTTT No data
Right 1043533659 8:81176618-81176640 AGCCAGAGCAGCCAGGATGTGGG No data
1043533650_1043533652 -10 Left 1043533650 8:81176582-81176604 CCCAGCTGTATCTGTGCCCCTTT No data
Right 1043533652 8:81176595-81176617 GTGCCCCTTTGAGCCAAGACTGG No data
1043533650_1043533658 12 Left 1043533650 8:81176582-81176604 CCCAGCTGTATCTGTGCCCCTTT No data
Right 1043533658 8:81176617-81176639 GAGCCAGAGCAGCCAGGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043533650 Original CRISPR AAAGGGGCACAGATACAGCT GGG (reversed) Intergenic
No off target data available for this crispr