ID: 1043542591

View in Genome Browser
Species Human (GRCh38)
Location 8:81280461-81280483
Sequence GCTATGCGGCCAATGGGAGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043542591_1043542604 22 Left 1043542591 8:81280461-81280483 CCGCCTCCCATTGGCCGCATAGC 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 42
1043542591_1043542602 16 Left 1043542591 8:81280461-81280483 CCGCCTCCCATTGGCCGCATAGC 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1043542602 8:81280500-81280522 CGCCGTTATAAAGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1043542591_1043542596 -9 Left 1043542591 8:81280461-81280483 CCGCCTCCCATTGGCCGCATAGC 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1043542596 8:81280475-81280497 CCGCATAGCGCCGCCCAGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 41
1043542591_1043542605 23 Left 1043542591 8:81280461-81280483 CCGCCTCCCATTGGCCGCATAGC 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1043542605 8:81280507-81280529 ATAAAGCAGCCGCCGGCGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 39
1043542591_1043542597 -8 Left 1043542591 8:81280461-81280483 CCGCCTCCCATTGGCCGCATAGC 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1043542597 8:81280476-81280498 CGCATAGCGCCGCCCAGCGCGGG 0: 1
1: 0
2: 1
3: 5
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043542591 Original CRISPR GCTATGCGGCCAATGGGAGG CGG (reversed) Exonic
901225727 1:7611946-7611968 GCCATGCGCCCACTGGGAGGGGG + Intronic
908108864 1:60874908-60874930 GCTGTGAGGCCAGAGGGAGGGGG - Intronic
912260606 1:108108505-108108527 GCTTTGTGGCAAATAGGAGGAGG - Intergenic
916179354 1:162070269-162070291 GCTTTGAGGCCAAGGTGAGGGGG + Exonic
916846413 1:168655131-168655153 GCTATGTGTCTAATGGAAGGTGG + Intergenic
918109674 1:181444418-181444440 GCTATGGGGGGAAAGGGAGGAGG + Intronic
921070910 1:211656877-211656899 TCTATGGGGCTGATGGGAGGTGG - Intergenic
922655490 1:227379021-227379043 GGGATACGGCCAATGGGATGTGG + Intergenic
1063374996 10:5549013-5549035 GCTCTGTGGTCACTGGGAGGTGG - Intergenic
1064129688 10:12697889-12697911 GCTTTGCGGGCAGTGGAAGGCGG + Intronic
1070511569 10:77165999-77166021 TCTCTGCGGGCTATGGGAGGAGG + Intronic
1072783145 10:98263647-98263669 GCCATGCAGCCAATGAGTGGTGG - Intronic
1074471397 10:113730207-113730229 GCTATGAGGATAATGGGAAGAGG + Exonic
1080938557 11:36887663-36887685 GACATGCGGAAAATGGGAGGGGG + Intergenic
1081921916 11:46786338-46786360 GCTGTGCAGCCACTGGCAGGTGG + Intronic
1084180439 11:67443251-67443273 GCTGGGCGGCCAAGGGGAGTGGG + Intronic
1088563004 11:111134816-111134838 GATATGTGGCTAATGGGTGGAGG + Intergenic
1089079991 11:115767601-115767623 GCTATGGGTCCCAGGGGAGGTGG - Intergenic
1090616897 11:128522717-128522739 ACTATGCTGCTACTGGGAGGGGG - Intronic
1091849317 12:3682479-3682501 TCTTTGCTGACAATGGGAGGAGG - Intronic
1092799916 12:12154257-12154279 GCTATGCGGATACTGGGAGAAGG - Intronic
1100199063 12:92279161-92279183 GCTATGGGGGCAGTGGGGGGAGG - Intergenic
1101323881 12:103697811-103697833 GCTAGGAGAACAATGGGAGGAGG + Intronic
1105660415 13:22487995-22488017 GCTATGGGCCAAATAGGAGGAGG + Intergenic
1106796163 13:33208212-33208234 GATATGAGGACAGTGGGAGGTGG + Intronic
1108326486 13:49337451-49337473 GCCATGTGGCCAGGGGGAGGTGG - Intronic
1113177304 13:107579517-107579539 GCCATGTGGCCAAGGGGAGAGGG - Intronic
1113655663 13:112066848-112066870 GCGCCGCGGCCAATGGGAGCCGG - Intergenic
1122543406 14:102509826-102509848 GCGCGGCGGCCAATGGGTGGTGG - Intergenic
1131075434 15:89492414-89492436 GCTGGGCTGCGAATGGGAGGGGG - Intronic
1134049987 16:11130710-11130732 GCTGTGCGGCCTATGGGGAGGGG - Intronic
1139299729 16:65934657-65934679 GCTAGGTGGGCACTGGGAGGTGG - Intergenic
1139661734 16:68425523-68425545 GCCATGAGGACAATGGGTGGGGG + Intronic
1142735774 17:1898477-1898499 GATGTGCGGCCAATGGCAGGCGG - Exonic
1146267940 17:31465396-31465418 GCTCTGGGGCCAATGGAAAGAGG - Intronic
1146629670 17:34460710-34460732 GCTTTGCGGCCAATGGACTGAGG - Intergenic
1158654002 18:59312031-59312053 GCTATCTGGCCCATGGCAGGAGG + Intronic
1160367054 18:78335434-78335456 CCTATGAGGCCAGAGGGAGGAGG + Intergenic
1162389472 19:10380589-10380611 TTCAGGCGGCCAATGGGAGGAGG - Exonic
1163084113 19:14966879-14966901 GCTGTGGGGGCAAAGGGAGGGGG + Intronic
1163591607 19:18197079-18197101 GCTGATCGGGCAATGGGAGGTGG - Exonic
1167053871 19:47096534-47096556 GCTGTGCAGACACTGGGAGGTGG + Intronic
1167244684 19:48365808-48365830 CCTTTGGGGCCACTGGGAGGTGG - Exonic
925032338 2:660733-660755 GCAATGCTGCTAATGGGAGGCGG + Intergenic
932723212 2:74154305-74154327 GCTAGGGAGCCAAGGGGAGGAGG - Exonic
935946165 2:108288640-108288662 GCTTCGAGGCCAGTGGGAGGAGG + Exonic
936531637 2:113280090-113280112 GCTAAGAAGCCAGTGGGAGGGGG + Intergenic
938278443 2:130048619-130048641 GCTTTGGGGAGAATGGGAGGAGG + Intergenic
940883645 2:158969778-158969800 GCGCTGCGGCCAAGGGGCGGAGG + Intronic
945525952 2:210888126-210888148 GCTATGCTGCCCATAGGATGGGG + Intergenic
1168928328 20:1600752-1600774 GCTAGGAGGCCAACTGGAGGTGG - Intronic
1170226332 20:13995427-13995449 GCAGTGCAGCCAATGGGAGGCGG + Exonic
1173024300 20:39293657-39293679 TCTTTGCGGCCAAGGGGATGTGG + Intergenic
1174582946 20:51585574-51585596 GCTACACATCCAATGGGAGGAGG + Intergenic
1175911512 20:62407335-62407357 GCGCCGCGGCCAATGGGCGGCGG - Intergenic
1176234068 20:64046090-64046112 GCTCTGCTGCCAATGGGGTGGGG + Intronic
1178507253 21:33171950-33171972 GGCATGCGGCCAGTGGGCGGTGG - Intergenic
1180615057 22:17121195-17121217 GCTAGGCGGCCGAGGGGAGCCGG + Exonic
950979703 3:17289217-17289239 GCTCAGCTGCCAATGGGAGGGGG - Intronic
951309453 3:21106304-21106326 GCTATCCTGCCCATGGGATGTGG - Intergenic
962496514 3:135945544-135945566 CCTATGAGACCAATTGGAGGTGG - Intergenic
971574569 4:28256755-28256777 GCTATGCTAGCAATGTGAGGAGG - Intergenic
981805348 4:148709079-148709101 GATATGCTACCAATGTGAGGAGG - Intergenic
987113995 5:14712524-14712546 GCGATGCTGCCGATGGGAGAGGG - Intronic
989467320 5:41772270-41772292 GCTTTGCAGACAGTGGGAGGAGG - Intronic
995877393 5:116804592-116804614 GACATGCAGCCCATGGGAGGAGG - Intergenic
997754284 5:136381289-136381311 GCAATGGGTGCAATGGGAGGTGG - Intronic
1001159608 5:169301208-169301230 GCGGCGCAGCCAATGGGAGGCGG - Intergenic
1002703878 5:181147594-181147616 CCTATGTGGGCAGTGGGAGGCGG + Intergenic
1003350150 6:5309008-5309030 GAGATGGGGCCAGTGGGAGGTGG - Intronic
1008174205 6:48246651-48246673 GCTATCCCTCCATTGGGAGGAGG + Intergenic
1014784042 6:125597719-125597741 GCTGTGGGGCCCATGGCAGGTGG - Intergenic
1015863376 6:137703285-137703307 GCCATGTGGCCATGGGGAGGAGG - Intergenic
1019404553 7:876844-876866 GCGGCGCGGCCAATGGGAGGCGG - Intronic
1024654034 7:51434178-51434200 GTCATGGGGCCAATGGCAGGTGG - Intergenic
1027287208 7:76659055-76659077 GCTATGCAGAAAATGGCAGGAGG + Intergenic
1039334014 8:36570244-36570266 GCTCTGCAGCCAGTGGGTGGTGG - Intergenic
1043542591 8:81280461-81280483 GCTATGCGGCCAATGGGAGGCGG - Exonic
1051362277 9:16291765-16291787 GCTGTGCCGCCAAGGGCAGGAGG + Intergenic
1052980447 9:34444542-34444564 GCTCTGCTACCAATGGGAGAGGG + Intronic
1057716910 9:97502396-97502418 GCTACGCGGCCAAGTGGAGCTGG + Intronic
1058994377 9:110285371-110285393 GGTGTGTGGGCAATGGGAGGAGG + Intergenic
1061050714 9:128193081-128193103 GCTCTGCGGCAGATGGGCGGCGG + Intronic
1186309951 X:8306997-8307019 TCTTTGCGGCCAATGAAAGGGGG - Intergenic
1189163162 X:38832015-38832037 GCAATGAGACCAATGGGAGCAGG - Intergenic
1192554368 X:72078212-72078234 GCTAATCTGCCAATGTGAGGGGG + Intergenic
1192589357 X:72346978-72347000 GCAATGCTGCCAAGGAGAGGAGG + Intronic
1192932617 X:75824209-75824231 GCTATGTGGCCTGTGGGATGGGG - Intergenic
1197069146 X:122272576-122272598 GGTATGCTGCAAGTGGGAGGAGG - Intergenic
1197345865 X:125325463-125325485 GCTGTGGGGCCAGTGGGAGATGG + Intergenic
1200229677 X:154437657-154437679 GCTAGGCGGGCAATGGGTGCGGG - Intronic