ID: 1043542592

View in Genome Browser
Species Human (GRCh38)
Location 8:81280464-81280486
Sequence GGCGCTATGCGGCCAATGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 22}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043542592_1043542605 20 Left 1043542592 8:81280464-81280486 CCTCCCATTGGCCGCATAGCGCC 0: 1
1: 0
2: 0
3: 4
4: 22
Right 1043542605 8:81280507-81280529 ATAAAGCAGCCGCCGGCGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 39
1043542592_1043542604 19 Left 1043542592 8:81280464-81280486 CCTCCCATTGGCCGCATAGCGCC 0: 1
1: 0
2: 0
3: 4
4: 22
Right 1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 42
1043542592_1043542602 13 Left 1043542592 8:81280464-81280486 CCTCCCATTGGCCGCATAGCGCC 0: 1
1: 0
2: 0
3: 4
4: 22
Right 1043542602 8:81280500-81280522 CGCCGTTATAAAGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 0
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043542592 Original CRISPR GGCGCTATGCGGCCAATGGG AGG (reversed) Exonic
1064007075 10:11707362-11707384 GGCCCTGTGCGGCCAGTAGGAGG + Intergenic
1066816631 10:39426416-39426438 GGCGCTTTGAGGCCTATGGTGGG - Intergenic
1067577435 10:47417433-47417455 GGGGCTCTGTGGCAAATGGGTGG - Intergenic
1067577518 10:47417811-47417833 GGGGCTCTGTGGCAAATGGGTGG - Intergenic
1084030005 11:66475787-66475809 GGCGCTGTGCGGCCACGGGCTGG - Exonic
1085050338 11:73376911-73376933 GGCGCGGGGCGGCCAAGGGGGGG + Intronic
1085121221 11:73968811-73968833 GGTGCTATGCGGCGAAGGGGCGG - Intronic
1088563003 11:111134813-111134835 GGAGATATGTGGCTAATGGGTGG + Intergenic
1093296480 12:17398288-17398310 GAGACTTTGCGGCCAATGGGAGG + Intergenic
1095056744 12:37615674-37615696 AGCGCTTTGAGGCCAATGGTGGG + Intergenic
1115399187 14:32938937-32938959 GGCGCTCTGCGGCGCATGGACGG + Intronic
1128994864 15:72288836-72288858 GGCGCTACGCGGCCTGGGGGAGG - Intronic
1144397086 17:14854964-14854986 GGAGCTATGGTGACAATGGGGGG - Intergenic
1146782234 17:35684754-35684776 GAGGCTCTGTGGCCAATGGGAGG - Intronic
1164881794 19:31738963-31738985 GGCCCTATGGGGAAAATGGGTGG + Intergenic
931515946 2:63050757-63050779 GGGGCTAGGCCGCCAATCGGGGG - Intronic
934747653 2:96770076-96770098 GGCCCCATGCAGCCTATGGGCGG + Intronic
942463865 2:176188593-176188615 GGCGCTGGCCGGCCAATGGGCGG - Exonic
1174380700 20:50153715-50153737 GGCGCTGGGCGGTCATTGGGCGG - Exonic
1175911513 20:62407338-62407360 GGCGCGCCGCGGCCAATGGGCGG - Intergenic
1182697155 22:32205399-32205421 GGCGCTATCCAGCCTATGGCTGG + Intergenic
956761289 3:72447178-72447200 CGCGCCGTGCGGCCAATGGGAGG + Intergenic
958275052 3:91566634-91566656 AGCGCTTTGAGGCCAATGGTAGG + Intergenic
958294995 3:91892463-91892485 AGCGCTTTGAGGCCAATGGTAGG + Intergenic
1017522303 6:155213211-155213233 GGAGGTATGCGGGCAAGGGGAGG + Intronic
1034622000 7:152463821-152463843 GGCGGTGCGAGGCCAATGGGAGG + Intergenic
1043542592 8:81280464-81280486 GGCGCTATGCGGCCAATGGGAGG - Exonic