ID: 1043542593

View in Genome Browser
Species Human (GRCh38)
Location 8:81280467-81280489
Sequence GGCGGCGCTATGCGGCCAAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 16
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 13}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043542593_1043542604 16 Left 1043542593 8:81280467-81280489 CCCATTGGCCGCATAGCGCCGCC 0: 1
1: 0
2: 0
3: 2
4: 13
Right 1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 42
1043542593_1043542605 17 Left 1043542593 8:81280467-81280489 CCCATTGGCCGCATAGCGCCGCC 0: 1
1: 0
2: 0
3: 2
4: 13
Right 1043542605 8:81280507-81280529 ATAAAGCAGCCGCCGGCGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 39
1043542593_1043542602 10 Left 1043542593 8:81280467-81280489 CCCATTGGCCGCATAGCGCCGCC 0: 1
1: 0
2: 0
3: 2
4: 13
Right 1043542602 8:81280500-81280522 CGCCGTTATAAAGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 0
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043542593 Original CRISPR GGCGGCGCTATGCGGCCAAT GGG (reversed) Exonic
1088311754 11:108467554-108467576 GGCGGGGCTAGGAGGGCAATGGG - Intergenic
1096485825 12:51980489-51980511 GGCAGTGCTGTGCGGCCCATGGG - Intronic
1134880993 16:17745429-17745451 GGCAGCGCTATGGGAACAATAGG + Intergenic
1136577132 16:31131543-31131565 GGGGGCGCTCAGCGGCCAGTGGG + Exonic
1138244731 16:55459083-55459105 GGCGGGTCTATGCAGCCCATGGG - Intronic
1162780196 19:13002729-13002751 TGCGGCGCTCTGCAGCCAATCGG + Intronic
927510220 2:23639757-23639779 GGGGGCGCTCTGGGGCCAATGGG - Intronic
1180000997 21:44995560-44995582 TGCGGCGCTTTGCCGCCCATTGG + Intergenic
1183425931 22:37739420-37739442 GGGGGCGCTATGCTGCCCAATGG - Intronic
1184906930 22:47494434-47494456 GGCAGTGCTCTGCGGCCAAAAGG + Intergenic
953886646 3:46717891-46717913 GGCCGCGGCATGCGGCCAACAGG - Exonic
986652807 5:9981094-9981116 GGAGGAGCTATGGGGCCATTAGG - Intergenic
1005111473 6:22286354-22286376 GGCAGAGCTATGGGGCGAATAGG + Intergenic
1035169508 7:157009864-157009886 GGCGGCGCTCTACGGCCACCCGG - Exonic
1043542593 8:81280467-81280489 GGCGGCGCTATGCGGCCAATGGG - Exonic
1200229679 X:154437663-154437685 GGCAACGCTAGGCGGGCAATGGG - Intronic