ID: 1043542594

View in Genome Browser
Species Human (GRCh38)
Location 8:81280468-81280490
Sequence GGGCGGCGCTATGCGGCCAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 34}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043542594_1043542605 16 Left 1043542594 8:81280468-81280490 CCATTGGCCGCATAGCGCCGCCC 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1043542605 8:81280507-81280529 ATAAAGCAGCCGCCGGCGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 39
1043542594_1043542602 9 Left 1043542594 8:81280468-81280490 CCATTGGCCGCATAGCGCCGCCC 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1043542602 8:81280500-81280522 CGCCGTTATAAAGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1043542594_1043542604 15 Left 1043542594 8:81280468-81280490 CCATTGGCCGCATAGCGCCGCCC 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043542594 Original CRISPR GGGCGGCGCTATGCGGCCAA TGG (reversed) Exonic
900658690 1:3772532-3772554 GGGCGGGGCCATGCGGGGAAGGG - Intergenic
905448770 1:38044443-38044465 GGGCCGCGCTATGCGGCGGTCGG + Exonic
906062758 1:42958986-42959008 GGGCGGCGCTCTGCGGGGAGGGG + Intergenic
906174407 1:43758146-43758168 GGGGGGTGGTATGCAGCCAATGG - Intronic
913121885 1:115749870-115749892 GAGCTGCGCTCTGCAGCCAACGG - Intronic
919724553 1:200873330-200873352 CGGCGGCGCTAGGCGGCCGCTGG + Exonic
920399232 1:205666882-205666904 GGGAGGGGTTCTGCGGCCAAAGG + Intronic
1065968133 10:30785208-30785230 GGGCGGCGCTGGGCGGCCCGGGG - Intergenic
1075337039 10:121616048-121616070 GGGCCGCGCTCTGAGCCCAAAGG - Intergenic
1094868662 12:34572710-34572732 GGGGAGCTCAATGCGGCCAAAGG - Intergenic
1096485826 12:51980490-51980512 GGGCAGTGCTGTGCGGCCCATGG - Intronic
1100992587 12:100267064-100267086 GGGCGGGGCTATGGTGCCAGGGG - Exonic
1109109500 13:58298314-58298336 GGGGAGCCATATGCGGCCAAAGG + Intergenic
1122707299 14:103629289-103629311 GGGCTGTGCTCGGCGGCCAAGGG + Intronic
1125508832 15:40282197-40282219 GGGCGGCGGCCTGCGGCCACGGG - Exonic
1130076494 15:80694984-80695006 GGGCGGGGCGCTGCGGGCAAGGG - Intronic
1138244732 16:55459084-55459106 GGGCGGGTCTATGCAGCCCATGG - Intronic
1138391817 16:56675896-56675918 GGGAGGGGCTATGCTGCCAGAGG - Intronic
1139754630 16:69132503-69132525 GCGCGGCGCCGCGCGGCCAACGG + Exonic
1143247785 17:5500736-5500758 GGGGGGCGCGATGCGGCCTTCGG + Intronic
1148593045 17:48831005-48831027 GGGCGGGGCTAAGCACCCAAGGG - Intronic
1152687981 17:81703857-81703879 GTGCGGCGTTTTGCGGCCAGGGG + Intronic
1161157409 19:2739883-2739905 GGGCGGCGCTGAGCGGCCGGGGG - Intronic
1162794013 19:13077442-13077464 GGGAGGCACTGTGCGGCCATGGG + Intronic
1168696774 19:58408288-58408310 GGGCGGCCCCATGGGGCCATCGG - Intronic
927510221 2:23639758-23639780 AGGGGGCGCTCTGGGGCCAATGG - Intronic
948178411 2:235961576-235961598 GGGTGGAGGTGTGCGGCCAAGGG + Intronic
955224598 3:57050420-57050442 GGGCAGCTCTATGCTGCCTATGG + Intronic
966855531 3:184191412-184191434 GAGCAGCGCTGTGCGGCCAGAGG - Intronic
984953069 4:185020571-185020593 GGGCCGCGCCAGGCGGCCAGGGG - Exonic
1004193967 6:13487688-13487710 GGGCGGCGCGCGGCGGCCAATGG - Intergenic
1019606644 7:1913456-1913478 GGGAGGCTCTCTGAGGCCAAAGG + Intronic
1043542594 8:81280468-81280490 GGGCGGCGCTATGCGGCCAATGG - Exonic
1049482755 8:142834744-142834766 GGGCGGGGCTGTGCGGCCGGCGG + Intronic
1062615720 9:137394910-137394932 TGGCGGCGCTAAGCCCCCAAGGG + Intronic
1187393387 X:18900550-18900572 GGGCGGCTCTATCCAGCAAACGG - Intronic