ID: 1043542595

View in Genome Browser
Species Human (GRCh38)
Location 8:81280475-81280497
Sequence CCGCGCTGGGCGGCGCTATG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 50}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043542595_1043542604 8 Left 1043542595 8:81280475-81280497 CCGCATAGCGCCGCCCAGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 42
1043542595_1043542605 9 Left 1043542595 8:81280475-81280497 CCGCATAGCGCCGCCCAGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1043542605 8:81280507-81280529 ATAAAGCAGCCGCCGGCGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 39
1043542595_1043542602 2 Left 1043542595 8:81280475-81280497 CCGCATAGCGCCGCCCAGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1043542602 8:81280500-81280522 CGCCGTTATAAAGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 0
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043542595 Original CRISPR CCGCGCTGGGCGGCGCTATG CGG (reversed) Exonic
901518870 1:9768303-9768325 CTGTGCTGGGCGGCACCATGGGG + Intronic
901836325 1:11926232-11926254 CCGCGCCTGGCGGCCCGATGTGG - Exonic
903572880 1:24319292-24319314 CCGAGGAGGGCGGAGCTATGGGG - Intergenic
906062752 1:42958979-42959001 CTGTCCTGGGCGGCGCTCTGCGG + Intergenic
915555484 1:156658589-156658611 CCGCCCACGGCTGCGCTATGAGG + Exonic
917749062 1:178037999-178038021 CGGGGCTGGGCGGCGCTGTCCGG - Intergenic
1062966598 10:1612026-1612048 CAGCGCTGGGGGGCACGATGAGG + Intronic
1065968136 10:30785215-30785237 CCGCGGGGGGCGGCGCTGGGCGG - Intergenic
1068080723 10:52314574-52314596 CACCGCTGGGCGGCGCTGCGGGG + Exonic
1072970019 10:100009666-100009688 CGGCGCTGTGCTGCGCTCTGTGG - Intronic
1076838021 10:133031005-133031027 CCGAGCTCCGCGGCGCTCTGAGG + Intergenic
1083267919 11:61555421-61555443 CTGGGCGGGGCGGCGCGATGCGG + Intronic
1083437556 11:62653122-62653144 CGGCGCGGGGCCGCGCGATGGGG + Intronic
1085521329 11:77140554-77140576 CCGCTCTGGGCTGGGCTCTGGGG + Intronic
1134531962 16:14990155-14990177 CCGCGCCTGGCGGCCCGATGTGG - Intronic
1138023382 16:53503733-53503755 CTGCGTTGGGCGGCGCTGCGAGG + Intronic
1141177522 16:81730623-81730645 CCGGGCTGGGAGGCTCTGTGAGG + Intergenic
1143016419 17:3893200-3893222 CCGCGGTGGGCGGCGCGGTAGGG + Intronic
1146398577 17:32487072-32487094 CGGCGCTCGGCGGCGCTCGGGGG - Exonic
1149491118 17:57085669-57085691 CGGCTCTGGGCGGCGCTCTGCGG + Intronic
1149678677 17:58488413-58488435 CCGCGCTGGGAGGCGCCGCGGGG - Intergenic
1152475707 17:80516725-80516747 CCACGCTGGGAGGTGCTCTGAGG + Intergenic
1154241609 18:12658129-12658151 CGGCGCTGGACGGCGCGAGGCGG - Exonic
1160703153 19:517845-517867 CCGGGCTGGGCGGTGCTGGGAGG + Intronic
1166518441 19:43463914-43463936 CCGCTCTGAGCGGCTCTTTGGGG - Intronic
1166694415 19:44844669-44844691 CCGCGCCGGGGGGCGGGATGAGG - Intergenic
1168528377 19:57106417-57106439 CCGAGCTGCGCGGGGCTGTGCGG + Intergenic
926095733 2:10079936-10079958 CCGGGCTGGGCGGCGCGGGGCGG + Exonic
926980247 2:18560519-18560541 CCGCTCTGGGCGGGGCGCTGTGG - Exonic
927295645 2:21449985-21450007 CCGTGCTGGGCTGTGCTAGGAGG - Intergenic
928093686 2:28391753-28391775 CCTCGCTGGGCGGGGCTGGGAGG - Intergenic
949056902 2:241932680-241932702 CGGCGCTGTGCGGCTCTAGGTGG + Intergenic
1169171744 20:3471014-3471036 CCGTGCGGGGCGGGGCTGTGCGG - Intergenic
1172837410 20:37881938-37881960 CGGCCCTGGGCAGGGCTATGGGG + Intergenic
1176235034 20:64049975-64049997 CCCCGCTGGGAGGCTCCATGGGG + Intronic
1180057359 21:45365782-45365804 CCGCGCTCGGAGGCACTTTGTGG - Intergenic
1180190294 21:46159656-46159678 CCGCCCCGGGCGGCCCTGTGTGG + Intergenic
953419249 3:42741874-42741896 CAGCGCTGGGAGGTGCAATGTGG + Intronic
960047478 3:113211925-113211947 CCGTGCGGCGCGGCGCTGTGTGG + Exonic
961760200 3:129161591-129161613 CGGCGCTGGGCGCGGTTATGTGG + Intergenic
969346643 4:6574681-6574703 CCCATCTGGGCGGCGCCATGGGG - Intergenic
978777492 4:112517396-112517418 CCGCGCTGGGGGGCGTTGTAGGG + Intergenic
985580527 5:693390-693412 CCGGGCTGGGCGGGGCTGGGCGG - Exonic
1006337444 6:33428004-33428026 CCGCGCCGGGCGGCGCGAGCCGG + Intronic
1016286092 6:142474599-142474621 CGGCGCTGGGCGCCGCCCTGCGG - Intergenic
1019529086 7:1494761-1494783 CCGGGCTGGGCGGGGCTGCGGGG - Intronic
1021389919 7:20079548-20079570 CGGTGCTGGGCGGCGCTGGGCGG + Intergenic
1043542595 8:81280475-81280497 CCGCGCTGGGCGGCGCTATGCGG - Exonic
1044306455 8:90645900-90645922 CCGCGCTGGGCCGAGGCATGCGG - Exonic
1057494865 9:95553114-95553136 CCGCGCTGGCCGGGCCTATGGGG - Intergenic
1058861245 9:109119642-109119664 CTGCTCTGGGCCGTGCTATGCGG - Exonic
1198533439 X:137566249-137566271 CCGGGCTGGGCTGCGCCAAGTGG - Exonic
1200277844 X:154751121-154751143 CCGCTCGGGGCGGCGCTGGGCGG - Intronic