ID: 1043542598

View in Genome Browser
Species Human (GRCh38)
Location 8:81280485-81280507
Sequence TAACGGCGGCCCGCGCTGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 40}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043542598_1043542604 -2 Left 1043542598 8:81280485-81280507 CCGCCCAGCGCGGGCCGCCGTTA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 42
1043542598_1043542602 -8 Left 1043542598 8:81280485-81280507 CCGCCCAGCGCGGGCCGCCGTTA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1043542602 8:81280500-81280522 CGCCGTTATAAAGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1043542598_1043542605 -1 Left 1043542598 8:81280485-81280507 CCGCCCAGCGCGGGCCGCCGTTA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1043542605 8:81280507-81280529 ATAAAGCAGCCGCCGGCGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043542598 Original CRISPR TAACGGCGGCCCGCGCTGGG CGG (reversed) Exonic
901120864 1:6892339-6892361 TAACTGCGGCCCCCTCTGAGAGG + Intronic
902476888 1:16693103-16693125 TGACGGCCGCCCGTGCTGGCCGG - Intergenic
904773315 1:32893101-32893123 CCAGGGCGGCCCGCGCTCGGTGG - Intronic
917443673 1:175088558-175088580 TAACAGTGGCCCAGGCTGGGTGG - Intronic
1069545028 10:69321493-69321515 TCATGGCTGCCCACGCTGGGGGG - Intronic
1077468526 11:2745770-2745792 TGAAGGCGGCCCTCGCTGAGCGG - Intronic
1083246193 11:61429890-61429912 TAACGGGGGCGCGCGGTCGGGGG - Exonic
1083607392 11:63986895-63986917 CAGCGGCGGCCCGCGCCGTGAGG + Intronic
1092881608 12:12891514-12891536 TAAAGGCGGCCCTCGCCGGAGGG - Exonic
1103377893 12:120470574-120470596 TCACGGCGCCCCGAGGTGGGAGG - Intronic
1103521239 12:121537888-121537910 TAACCGCGGGCCGCGCTGCCCGG - Intronic
1122876299 14:104667199-104667221 TCACGGCGGCCTGCGTTGTGTGG - Intergenic
1129540383 15:76342970-76342992 TCACGGCCGCCCGCTCTGGCCGG - Intergenic
1136365375 16:29806908-29806930 CCGCGGCGGCCCGGGCTGGGGGG + Intronic
1142189381 16:88710831-88710853 AGGCGGCGGCCCGCGCAGGGAGG + Intronic
1145163121 17:20589141-20589163 TGACGGCGGCGGGGGCTGGGGGG + Intergenic
1161108769 19:2456905-2456927 CGACGGCGGCCCGGGCTCGGCGG + Exonic
1165838038 19:38771166-38771188 TTCCGGAGGCCCGTGCTGGGTGG + Intronic
1165841527 19:38791531-38791553 TTCCGGAGGCCCGTGCTGGGTGG - Intronic
1165895140 19:39136812-39136834 TAATGGGGACCCGCCCTGGGTGG + Intronic
1166071626 19:40391333-40391355 TAACAGCGGGCCGGGCTCGGTGG + Intergenic
1202710903 1_KI270714v1_random:18929-18951 TGACGGCCGCCCGTGCTGGCCGG - Intergenic
926285178 2:11482605-11482627 TAGCGGCGGCCGGCGATGGGTGG - Intergenic
936909654 2:117576924-117576946 TTAAGGCTGCCCGGGCTGGGAGG + Intergenic
942681262 2:178480306-178480328 TAAAGGCGGCCCTGGCTGGCAGG + Intergenic
944547490 2:200812174-200812196 TAGCGGCGGCCCGGGTGGGGAGG + Intronic
948800308 2:240430419-240430441 TGCCGCCGGCCTGCGCTGGGTGG - Intergenic
1168750766 20:279453-279475 TAAACGCGGCCCAAGCTGGGCGG + Intronic
1171823114 20:29873872-29873894 TGACGGCGGGACGCTCTGGGAGG + Intergenic
1183607071 22:38872091-38872113 CAGCGGCGGCCCGCCCCGGGCGG + Intronic
961736278 3:129003894-129003916 CGGCGGAGGCCCGCGCTGGGCGG + Exonic
985616562 5:926569-926591 GGACGGCGGCCCCCGCAGGGCGG - Intergenic
1016738550 6:147506823-147506845 AGGCGGCGGCCCGCGCGGGGCGG + Intergenic
1023869155 7:44253568-44253590 TAACGGAGGACCTCGCTAGGTGG - Intronic
1043542598 8:81280485-81280507 TAACGGCGGCCCGCGCTGGGCGG - Exonic
1049647079 8:143740292-143740314 TGAGGGCGGCGCGCGCGGGGCGG - Intergenic
1051697912 9:19788919-19788941 GAGCGGCGGGCCGCGCTCGGGGG - Intergenic
1056812890 9:89777887-89777909 GAAGGGCAGCCCGAGCTGGGTGG - Intergenic
1061188866 9:129070451-129070473 TAGAGGCGGCACGGGCTGGGGGG + Exonic
1062389232 9:136327469-136327491 TCACCGCCGCCCGCGCGGGGAGG - Exonic
1203376185 Un_KI270442v1:380421-380443 TGACGGCGGGACGCTCTGGGAGG + Intergenic
1199772832 X:150984709-150984731 CAGCGGCGGCCCGGGCGGGGCGG - Intronic