ID: 1043542599

View in Genome Browser
Species Human (GRCh38)
Location 8:81280488-81280510
Sequence TTATAACGGCGGCCCGCGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 5}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043542599_1043542605 -4 Left 1043542599 8:81280488-81280510 CCCAGCGCGGGCCGCCGTTATAA 0: 1
1: 0
2: 0
3: 0
4: 5
Right 1043542605 8:81280507-81280529 ATAAAGCAGCCGCCGGCGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 39
1043542599_1043542604 -5 Left 1043542599 8:81280488-81280510 CCCAGCGCGGGCCGCCGTTATAA 0: 1
1: 0
2: 0
3: 0
4: 5
Right 1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043542599 Original CRISPR TTATAACGGCGGCCCGCGCT GGG (reversed) Exonic
1133121597 16:3611892-3611914 ATACAACGGCGGCCCCCTCTGGG + Intronic
1163427181 19:17246008-17246030 TTATAAGGGCGGCCGTCGCCGGG - Intronic
1177649427 21:23941434-23941456 TTATAACTGCCCCCCGCCCTTGG + Intergenic
1179394395 21:41024787-41024809 TTAAAAGGGAGGCCGGCGCTGGG - Intergenic
1043542599 8:81280488-81280510 TTATAACGGCGGCCCGCGCTGGG - Exonic
1193699434 X:84743737-84743759 TTATAACAGCAGCCCTAGCTGGG + Intergenic