ID: 1043542600

View in Genome Browser
Species Human (GRCh38)
Location 8:81280489-81280511
Sequence TTTATAACGGCGGCCCGCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 11
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 9}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043542600_1043542604 -6 Left 1043542600 8:81280489-81280511 CCAGCGCGGGCCGCCGTTATAAA 0: 1
1: 0
2: 0
3: 1
4: 9
Right 1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 42
1043542600_1043542605 -5 Left 1043542600 8:81280489-81280511 CCAGCGCGGGCCGCCGTTATAAA 0: 1
1: 0
2: 0
3: 1
4: 9
Right 1043542605 8:81280507-81280529 ATAAAGCAGCCGCCGGCGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043542600 Original CRISPR TTTATAACGGCGGCCCGCGC TGG (reversed) Exonic
900926194 1:5707720-5707742 TTTGTCACGGCAGCCCGAGCAGG + Intergenic
904557202 1:31373082-31373104 TTTAAAGCGGCAGCCCGGGCAGG - Intronic
1092881610 12:12891518-12891540 GTTATAAAGGCGGCCCTCGCCGG - Exonic
1163427182 19:17246009-17246031 CTTATAAGGGCGGCCGTCGCCGG - Intronic
1165311324 19:35030774-35030796 TTAATACCGGCGGCCCGGGAGGG + Intronic
935918690 2:107986477-107986499 TTTATAAGGGCGGCAGGCGGGGG - Intergenic
1184532312 22:45064057-45064079 TTTATGACGAAGGCCCACGCTGG + Intergenic
994659601 5:102637695-102637717 TTTATAACTTCGGCCCGGCCCGG - Intergenic
1022097616 7:27150773-27150795 TCTATAACGGCGTCCAGCTCCGG + Intronic
1043542600 8:81280489-81280511 TTTATAACGGCGGCCCGCGCTGG - Exonic
1187297392 X:18015105-18015127 TTTATAAGGGCTCCCCGCTCCGG - Intergenic