ID: 1043542604

View in Genome Browser
Species Human (GRCh38)
Location 8:81280506-81280528
Sequence TATAAAGCAGCCGCCGGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 42}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043542594_1043542604 15 Left 1043542594 8:81280468-81280490 CCATTGGCCGCATAGCGCCGCCC 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 42
1043542595_1043542604 8 Left 1043542595 8:81280475-81280497 CCGCATAGCGCCGCCCAGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 42
1043542591_1043542604 22 Left 1043542591 8:81280461-81280483 CCGCCTCCCATTGGCCGCATAGC 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 42
1043542598_1043542604 -2 Left 1043542598 8:81280485-81280507 CCGCCCAGCGCGGGCCGCCGTTA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 42
1043542593_1043542604 16 Left 1043542593 8:81280467-81280489 CCCATTGGCCGCATAGCGCCGCC 0: 1
1: 0
2: 0
3: 2
4: 13
Right 1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 42
1043542599_1043542604 -5 Left 1043542599 8:81280488-81280510 CCCAGCGCGGGCCGCCGTTATAA 0: 1
1: 0
2: 0
3: 0
4: 5
Right 1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 42
1043542592_1043542604 19 Left 1043542592 8:81280464-81280486 CCTCCCATTGGCCGCATAGCGCC 0: 1
1: 0
2: 0
3: 4
4: 22
Right 1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 42
1043542590_1043542604 23 Left 1043542590 8:81280460-81280482 CCCGCCTCCCATTGGCCGCATAG 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 42
1043542600_1043542604 -6 Left 1043542600 8:81280489-81280511 CCAGCGCGGGCCGCCGTTATAAA 0: 1
1: 0
2: 0
3: 1
4: 9
Right 1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043542604 Original CRISPR TATAAAGCAGCCGCCGGCGC CGG Exonic
913680968 1:121186681-121186703 TTTGGAGCAGCCGCCTGCGCGGG - Intronic
914032799 1:143974320-143974342 TTTGGAGCAGCCGCCTGCGCGGG - Intergenic
914156648 1:145093645-145093667 TTTGGAGCAGCCGCCTGCGCGGG + Intronic
915393232 1:155562743-155562765 TGTCAAGCCGGCGCCGGCGCAGG + Intronic
920468280 1:206205205-206205227 TTTGGAGCAGCCGCCTGCGCGGG - Intronic
921411352 1:214839557-214839579 AATAAAGCTGCAGCCGGCTCAGG + Intergenic
923546729 1:234928769-234928791 TGTAAATCAGCTGCCGGGGCAGG + Intergenic
1066963604 10:42242298-42242320 TATGGAGCAGTCGCCGCCGCCGG - Intergenic
1067181050 10:43986249-43986271 TAGAAAGCTGCCGCCATCGCTGG - Intergenic
1078088899 11:8251631-8251653 AATCCAGCAGCCCCCGGCGCTGG + Intronic
1078904379 11:15670847-15670869 AATGGAGCAGCCGCCGGCCCAGG + Intergenic
1083683488 11:64361909-64361931 TACAAAGCAGCCGCTGCAGCAGG - Exonic
1100586418 12:95984555-95984577 TATAAAGCAGCACCTGGCTCTGG + Intronic
1103361464 12:120356868-120356890 CAGAAAGAAGCCGCAGGCGCAGG + Intronic
1121022600 14:90590235-90590257 TACAAAGCAGCTGGCGGCACAGG + Intronic
1122079370 14:99256499-99256521 TAAAAAGCAGCAGCCTGTGCTGG - Intronic
1131827074 15:96330590-96330612 TATAAGGCAGCAGCCGGGGTTGG - Intronic
1133519946 16:6547271-6547293 TATAAATCACCAGCCGGGGCTGG - Intronic
1135607287 16:23835864-23835886 TGTAAAGCAGCTGGCAGCGCTGG + Intergenic
1136504867 16:30696637-30696659 TATAAAGCAGCTGGGGGCGGTGG + Intergenic
1136838093 16:33516672-33516694 TATGGAGCAGTCGCCGCCGCTGG - Intergenic
1138283469 16:55790281-55790303 TTTAAAACAGCTGCCGGTGCAGG - Intergenic
1138285532 16:55806706-55806728 TTTAAAACAGCTGCCGGTGCAGG + Intronic
1142415151 16:89937050-89937072 TACACAGCAGCAGCCGGCGGAGG - Intergenic
1203148266 16_KI270728v1_random:1816952-1816974 TATGGAGCAGTCGCCGCCGCTGG - Intergenic
1142474374 17:180766-180788 ACAAAAGCAGCCGCCCGCGCCGG + Intronic
1146660983 17:34665034-34665056 TATAAAGGAACAGCTGGCGCTGG + Intergenic
1161597254 19:5156839-5156861 TCTAAAGCAGCTGCTGGGGCTGG - Intergenic
1163018997 19:14472850-14472872 TATAGAGCAGGCGCGGGCGCAGG + Intronic
1180932341 22:19600992-19601014 TATCAAGCAGCCTCCAGTGCCGG - Intergenic
968418762 4:464781-464803 TAAAAAGCAGCAGCTGGGGCTGG + Intronic
979565796 4:122152694-122152716 TATGAAGGAGTCGCCGCCGCAGG - Intronic
985030890 4:185788103-185788125 AACAAAGCAGCAGCTGGCGCTGG - Intronic
994083203 5:95731144-95731166 CACAAAGGAGCCGCCCGCGCGGG - Intronic
1035170420 7:157014332-157014354 TAGAAAGCAGGCTCCCGCGCTGG - Intergenic
1036757115 8:11477895-11477917 TATGAAGCAGCAGCCGTGGCTGG + Intergenic
1037260434 8:17001822-17001844 AATAGAGCTGCCGGCGGCGCAGG + Exonic
1041690274 8:60680045-60680067 TATTATGCAGCTGCCGCCGCCGG - Intronic
1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG + Exonic
1048077337 8:131086000-131086022 TATAAAGCAGCAGGAGGCCCTGG + Intergenic
1049194594 8:141308384-141308406 TATGCAGCACCCGCCGCCGCGGG + Intergenic
1060811703 9:126614150-126614172 TCTGCAGCAGCCGCCGCCGCCGG + Intergenic
1061693632 9:132355068-132355090 CAGAAAGCAGCGGCCGGGGCGGG - Intergenic
1202090260 Y:21181219-21181241 TGTAAAGCAGCCTCCACCGCGGG + Intergenic