ID: 1043546746

View in Genome Browser
Species Human (GRCh38)
Location 8:81324058-81324080
Sequence AGGGTGACTAGAATGGCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043546746_1043546756 16 Left 1043546746 8:81324058-81324080 CCCCTAGCCATTCTAGTCACCCT No data
Right 1043546756 8:81324097-81324119 TGCTAGGTATTTGCAACTGCTGG No data
1043546746_1043546755 0 Left 1043546746 8:81324058-81324080 CCCCTAGCCATTCTAGTCACCCT No data
Right 1043546755 8:81324081-81324103 GTGGGGTGCAAGATATTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043546746 Original CRISPR AGGGTGACTAGAATGGCTAG GGG (reversed) Intergenic
No off target data available for this crispr