ID: 1043548209

View in Genome Browser
Species Human (GRCh38)
Location 8:81338877-81338899
Sequence CATTTCCAATTTAAAATGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043548209_1043548210 -5 Left 1043548209 8:81338877-81338899 CCTTACATTTTAAATTGGAAATG No data
Right 1043548210 8:81338895-81338917 AAATGCCTCTGTATTCTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043548209 Original CRISPR CATTTCCAATTTAAAATGTA AGG (reversed) Intergenic
No off target data available for this crispr