ID: 1043549079

View in Genome Browser
Species Human (GRCh38)
Location 8:81348681-81348703
Sequence ATGGCAGGACTGATCCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043549074_1043549079 3 Left 1043549074 8:81348655-81348677 CCAGAGGTGGGCAAGGCAGTGTG No data
Right 1043549079 8:81348681-81348703 ATGGCAGGACTGATCCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043549079 Original CRISPR ATGGCAGGACTGATCCATGG TGG Intergenic
No off target data available for this crispr