ID: 1043549176

View in Genome Browser
Species Human (GRCh38)
Location 8:81349515-81349537
Sequence TTTCCACAGTCAGAGATCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043549176_1043549183 8 Left 1043549176 8:81349515-81349537 CCTGAGATCTCTGACTGTGGAAA No data
Right 1043549183 8:81349546-81349568 ACATGGGGGTACATTTAATGGGG No data
1043549176_1043549185 21 Left 1043549176 8:81349515-81349537 CCTGAGATCTCTGACTGTGGAAA No data
Right 1043549185 8:81349559-81349581 TTTAATGGGGTTTAATGAGGTGG No data
1043549176_1043549182 7 Left 1043549176 8:81349515-81349537 CCTGAGATCTCTGACTGTGGAAA No data
Right 1043549182 8:81349545-81349567 TACATGGGGGTACATTTAATGGG No data
1043549176_1043549179 -7 Left 1043549176 8:81349515-81349537 CCTGAGATCTCTGACTGTGGAAA No data
Right 1043549179 8:81349531-81349553 GTGGAAATGAGAACTACATGGGG No data
1043549176_1043549181 6 Left 1043549176 8:81349515-81349537 CCTGAGATCTCTGACTGTGGAAA No data
Right 1043549181 8:81349544-81349566 CTACATGGGGGTACATTTAATGG No data
1043549176_1043549178 -8 Left 1043549176 8:81349515-81349537 CCTGAGATCTCTGACTGTGGAAA No data
Right 1043549178 8:81349530-81349552 TGTGGAAATGAGAACTACATGGG No data
1043549176_1043549177 -9 Left 1043549176 8:81349515-81349537 CCTGAGATCTCTGACTGTGGAAA No data
Right 1043549177 8:81349529-81349551 CTGTGGAAATGAGAACTACATGG No data
1043549176_1043549184 18 Left 1043549176 8:81349515-81349537 CCTGAGATCTCTGACTGTGGAAA No data
Right 1043549184 8:81349556-81349578 ACATTTAATGGGGTTTAATGAGG No data
1043549176_1043549180 -6 Left 1043549176 8:81349515-81349537 CCTGAGATCTCTGACTGTGGAAA No data
Right 1043549180 8:81349532-81349554 TGGAAATGAGAACTACATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043549176 Original CRISPR TTTCCACAGTCAGAGATCTC AGG (reversed) Intergenic
No off target data available for this crispr