ID: 1043549464

View in Genome Browser
Species Human (GRCh38)
Location 8:81353603-81353625
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043549464_1043549467 24 Left 1043549464 8:81353603-81353625 CCAGAGTGTGTTAGAGGTGAATT No data
Right 1043549467 8:81353650-81353672 TTGCTGGCATTGATCAACACAGG No data
1043549464_1043549466 8 Left 1043549464 8:81353603-81353625 CCAGAGTGTGTTAGAGGTGAATT No data
Right 1043549466 8:81353634-81353656 AATTGCTTCATGGAGCTTGCTGG No data
1043549464_1043549465 -2 Left 1043549464 8:81353603-81353625 CCAGAGTGTGTTAGAGGTGAATT No data
Right 1043549465 8:81353624-81353646 TTGCTTCATGAATTGCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043549464 Original CRISPR AATTCACCTCTAACACACTC TGG (reversed) Intergenic
No off target data available for this crispr