ID: 1043549467 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:81353650-81353672 |
| Sequence | TTGCTGGCATTGATCAACAC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1043549463_1043549467 | 25 | Left | 1043549463 | 8:81353602-81353624 | CCCAGAGTGTGTTAGAGGTGAAT | No data | ||
| Right | 1043549467 | 8:81353650-81353672 | TTGCTGGCATTGATCAACACAGG | No data | ||||
| 1043549464_1043549467 | 24 | Left | 1043549464 | 8:81353603-81353625 | CCAGAGTGTGTTAGAGGTGAATT | No data | ||
| Right | 1043549467 | 8:81353650-81353672 | TTGCTGGCATTGATCAACACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1043549467 | Original CRISPR | TTGCTGGCATTGATCAACAC AGG | Intergenic | ||
| No off target data available for this crispr | |||||