ID: 1043551326

View in Genome Browser
Species Human (GRCh38)
Location 8:81376206-81376228
Sequence CATCCATCCCTTCTGGAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043551326_1043551333 25 Left 1043551326 8:81376206-81376228 CCCTATTCCAGAAGGGATGGATG No data
Right 1043551333 8:81376254-81376276 GCAAGGGAGTGACAAAAAGAAGG No data
1043551326_1043551331 8 Left 1043551326 8:81376206-81376228 CCCTATTCCAGAAGGGATGGATG No data
Right 1043551331 8:81376237-81376259 TTCACATACATTAAGCAGCAAGG No data
1043551326_1043551332 9 Left 1043551326 8:81376206-81376228 CCCTATTCCAGAAGGGATGGATG No data
Right 1043551332 8:81376238-81376260 TCACATACATTAAGCAGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043551326 Original CRISPR CATCCATCCCTTCTGGAATA GGG (reversed) Intergenic
No off target data available for this crispr