ID: 1043551333

View in Genome Browser
Species Human (GRCh38)
Location 8:81376254-81376276
Sequence GCAAGGGAGTGACAAAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043551329_1043551333 18 Left 1043551329 8:81376213-81376235 CCAGAAGGGATGGATGCCTGGTT No data
Right 1043551333 8:81376254-81376276 GCAAGGGAGTGACAAAAAGAAGG No data
1043551327_1043551333 24 Left 1043551327 8:81376207-81376229 CCTATTCCAGAAGGGATGGATGC No data
Right 1043551333 8:81376254-81376276 GCAAGGGAGTGACAAAAAGAAGG No data
1043551326_1043551333 25 Left 1043551326 8:81376206-81376228 CCCTATTCCAGAAGGGATGGATG No data
Right 1043551333 8:81376254-81376276 GCAAGGGAGTGACAAAAAGAAGG No data
1043551330_1043551333 2 Left 1043551330 8:81376229-81376251 CCTGGTTCTTCACATACATTAAG No data
Right 1043551333 8:81376254-81376276 GCAAGGGAGTGACAAAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043551333 Original CRISPR GCAAGGGAGTGACAAAAAGA AGG Intergenic
No off target data available for this crispr