ID: 1043558387

View in Genome Browser
Species Human (GRCh38)
Location 8:81461110-81461132
Sequence CTGTCTATAAATTTGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043558384_1043558387 23 Left 1043558384 8:81461064-81461086 CCTTGAAACAAATTTAATTGATC 0: 1
1: 0
2: 3
3: 32
4: 293
Right 1043558387 8:81461110-81461132 CTGTCTATAAATTTGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043558387 Original CRISPR CTGTCTATAAATTTGAAGCT GGG Intronic
No off target data available for this crispr