ID: 1043558519

View in Genome Browser
Species Human (GRCh38)
Location 8:81462810-81462832
Sequence TGAGGCACTTATTTTGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043558519_1043558521 0 Left 1043558519 8:81462810-81462832 CCAAGCTCAAAATAAGTGCCTCA No data
Right 1043558521 8:81462833-81462855 GCAGTTGAAAGTGCATTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043558519 Original CRISPR TGAGGCACTTATTTTGAGCT TGG (reversed) Intergenic
No off target data available for this crispr