ID: 1043560460

View in Genome Browser
Species Human (GRCh38)
Location 8:81487801-81487823
Sequence TTGGTGAAGAACCAGGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043560460_1043560463 8 Left 1043560460 8:81487801-81487823 CCTGGCACCTGGTTCTTCACCAA No data
Right 1043560463 8:81487832-81487854 ATTAATAAATAATTAACAAAAGG No data
1043560460_1043560464 20 Left 1043560460 8:81487801-81487823 CCTGGCACCTGGTTCTTCACCAA No data
Right 1043560464 8:81487844-81487866 TTAACAAAAGGAATAAGATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043560460 Original CRISPR TTGGTGAAGAACCAGGTGCC AGG (reversed) Intergenic
No off target data available for this crispr