ID: 1043564962

View in Genome Browser
Species Human (GRCh38)
Location 8:81537746-81537768
Sequence TCAAATGCACACCTGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043564956_1043564962 19 Left 1043564956 8:81537704-81537726 CCATTCATGAGGCTCAGGGTGTT No data
Right 1043564962 8:81537746-81537768 TCAAATGCACACCTGGAGGTGGG No data
1043564958_1043564962 -8 Left 1043564958 8:81537731-81537753 CCTTGGTGCTGCTACTCAAATGC No data
Right 1043564962 8:81537746-81537768 TCAAATGCACACCTGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043564962 Original CRISPR TCAAATGCACACCTGGAGGT GGG Intergenic
No off target data available for this crispr