ID: 1043566631

View in Genome Browser
Species Human (GRCh38)
Location 8:81556250-81556272
Sequence TGATTTGGTGAGGATACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043566627_1043566631 23 Left 1043566627 8:81556204-81556226 CCGGCAGGAATGTGTTGTGTCTG No data
Right 1043566631 8:81556250-81556272 TGATTTGGTGAGGATACAGAAGG No data
1043566628_1043566631 -2 Left 1043566628 8:81556229-81556251 CCTGTTTAACATTTCTGTAAGTG No data
Right 1043566631 8:81556250-81556272 TGATTTGGTGAGGATACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043566631 Original CRISPR TGATTTGGTGAGGATACAGA AGG Intergenic
No off target data available for this crispr