ID: 1043567454

View in Genome Browser
Species Human (GRCh38)
Location 8:81563054-81563076
Sequence GCTGAGCTGCCTGGAGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043567454_1043567459 12 Left 1043567454 8:81563054-81563076 CCCGCAGCTCCAGGCAGCTCAGC No data
Right 1043567459 8:81563089-81563111 ACTTTGTTTGAGGGAAATGAAGG No data
1043567454_1043567457 2 Left 1043567454 8:81563054-81563076 CCCGCAGCTCCAGGCAGCTCAGC No data
Right 1043567457 8:81563079-81563101 ACAGAGAGATACTTTGTTTGAGG No data
1043567454_1043567458 3 Left 1043567454 8:81563054-81563076 CCCGCAGCTCCAGGCAGCTCAGC No data
Right 1043567458 8:81563080-81563102 CAGAGAGATACTTTGTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043567454 Original CRISPR GCTGAGCTGCCTGGAGCTGC GGG (reversed) Intergenic