ID: 1043573411

View in Genome Browser
Species Human (GRCh38)
Location 8:81630483-81630505
Sequence GTGACCAGGACAGAAACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043573411_1043573420 16 Left 1043573411 8:81630483-81630505 CCTGCTGTTTCTGTCCTGGTCAC No data
Right 1043573420 8:81630522-81630544 GAGCCAGGCCATCTTCCTCTCGG No data
1043573411_1043573416 1 Left 1043573411 8:81630483-81630505 CCTGCTGTTTCTGTCCTGGTCAC No data
Right 1043573416 8:81630507-81630529 CCCTTCCCAGCGTGGGAGCCAGG No data
1043573411_1043573413 -7 Left 1043573411 8:81630483-81630505 CCTGCTGTTTCTGTCCTGGTCAC No data
Right 1043573413 8:81630499-81630521 TGGTCACACCCTTCCCAGCGTGG No data
1043573411_1043573414 -6 Left 1043573411 8:81630483-81630505 CCTGCTGTTTCTGTCCTGGTCAC No data
Right 1043573414 8:81630500-81630522 GGTCACACCCTTCCCAGCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043573411 Original CRISPR GTGACCAGGACAGAAACAGC AGG (reversed) Intergenic
No off target data available for this crispr