ID: 1043578383

View in Genome Browser
Species Human (GRCh38)
Location 8:81683830-81683852
Sequence TTGGATCATACTGATTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 2, 2: 1, 3: 15, 4: 198}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043578383_1043578387 -3 Left 1043578383 8:81683830-81683852 CCCACAAAATCAGTATGATCCAA 0: 1
1: 2
2: 1
3: 15
4: 198
Right 1043578387 8:81683850-81683872 CAAATGGAACAGACTGACTGTGG No data
1043578383_1043578390 23 Left 1043578383 8:81683830-81683852 CCCACAAAATCAGTATGATCCAA 0: 1
1: 2
2: 1
3: 15
4: 198
Right 1043578390 8:81683876-81683898 CCCAGCAAGGACTGTCCATTCGG No data
1043578383_1043578388 10 Left 1043578383 8:81683830-81683852 CCCACAAAATCAGTATGATCCAA 0: 1
1: 2
2: 1
3: 15
4: 198
Right 1043578388 8:81683863-81683885 CTGACTGTGGAAACCCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043578383 Original CRISPR TTGGATCATACTGATTTTGT GGG (reversed) Intronic
900849749 1:5133086-5133108 TTGGATGAAAATGATTTTCTAGG + Intergenic
901032673 1:6316918-6316940 TTGGATCATATTCTTTGTGTTGG - Intronic
902129743 1:14249445-14249467 CTGGAACTTCCTGATTTTGTGGG - Intergenic
902224267 1:14986841-14986863 TGGGAACCTACTGATTATGTGGG - Intronic
909701988 1:78535263-78535285 TTGTATCATACGGAATTTGCAGG + Intronic
910813439 1:91262650-91262672 TTGGATCATAATGATTTTTGGGG + Intronic
911778172 1:101841760-101841782 TTGTATTATCCTGATTTTCTGGG + Intronic
912053580 1:105565873-105565895 TGGGAGGATACTGATTGTGTGGG - Intergenic
916029779 1:160865624-160865646 CTGGTTTATATTGATTTTGTAGG - Intergenic
916605764 1:166341682-166341704 TTTGATCATTGTTATTTTGTTGG + Intergenic
917793972 1:178519395-178519417 TTGGAACATGATGATTTTGAAGG + Intronic
919190184 1:194206405-194206427 TTGGATAATAATGATTTTACAGG - Intergenic
1063926801 10:10986410-10986432 TTCTTTAATACTGATTTTGTGGG + Intergenic
1064618560 10:17191094-17191116 TGGGAACATGCTGGTTTTGTAGG + Intronic
1065567873 10:27033144-27033166 TTTTATCATACTAATTTAGTGGG - Intronic
1068254901 10:54497004-54497026 CTGGACCATAGTGCTTTTGTTGG + Intronic
1070939482 10:80330788-80330810 CGGGATCAAATTGATTTTGTAGG - Intergenic
1074693472 10:116027483-116027505 TTGGATGATACTAATTTAATTGG + Intergenic
1078958433 11:16231889-16231911 TGGGATGATTCTAATTTTGTGGG + Intronic
1079242453 11:18730056-18730078 TTGGATGATCCTGAAGTTGTTGG - Intronic
1079793067 11:24764033-24764055 ATGGATAATATTTATTTTGTTGG + Intronic
1082663311 11:55942269-55942291 TTTGATCATACTTATTGTTTCGG - Intergenic
1083394155 11:62377653-62377675 ATTGGTCTTACTGATTTTGTGGG - Intronic
1083969813 11:66068054-66068076 TTGGAGGATACTGCTTTTGGAGG + Intronic
1086749080 11:90467557-90467579 TTGGATCATACCGTAATTGTTGG - Intergenic
1087885680 11:103479238-103479260 TTAGATTCTACTGATTTTTTAGG - Exonic
1089829542 11:121314685-121314707 TTTTAACATACTAATTTTGTGGG - Intergenic
1090118039 11:123995607-123995629 TTGCATCTTATTGATTTTCTAGG + Intergenic
1090492833 11:127180249-127180271 TTGTACCCTACTGCTTTTGTAGG - Intergenic
1092185859 12:6477984-6478006 TTGGTTGAAAATGATTTTGTTGG + Intergenic
1093887390 12:24478025-24478047 TTGAATTATATTGATTTTGAGGG - Intergenic
1094313886 12:29116060-29116082 TATGATTATCCTGATTTTGTAGG - Intergenic
1094701993 12:32878960-32878982 TTGGTTGAAAATGATTTTGTTGG - Exonic
1095594835 12:43947676-43947698 TTGCATTACACTGAATTTGTGGG + Intronic
1095729625 12:45492356-45492378 GTGGAACATACTTATTCTGTGGG + Intergenic
1095876755 12:47087695-47087717 TTAGATCTTACTCATTTTGTTGG + Intronic
1097203903 12:57303825-57303847 TTGGAAGACACTGATTTTGTTGG + Intronic
1097778309 12:63673501-63673523 TTGGAGCTTACTTATTTTCTAGG + Intergenic
1097913016 12:64990711-64990733 TTGGGTCAAATTGATTTGGTTGG + Intergenic
1098672758 12:73252021-73252043 TTGGATCAGGCTGAATTTATTGG + Intergenic
1098748991 12:74271749-74271771 CTGGATCATACTGGATATGTAGG + Intergenic
1098755632 12:74359719-74359741 TGGGATGATTCTAATTTTGTTGG - Intergenic
1099322366 12:81166376-81166398 TTTGATAATACTGAGTTTGAAGG + Intronic
1099375473 12:81892676-81892698 GTGGATCACAATGATTTTTTGGG - Intergenic
1099392132 12:82094619-82094641 TAGGATGATACTGGCTTTGTAGG + Intergenic
1099883749 12:88501354-88501376 TTGGATTATAATCATTTTCTTGG - Intronic
1100294832 12:93251049-93251071 TAAAATCATACTGATTTTATGGG - Intergenic
1101050927 12:100863187-100863209 GTGGATTATACAGATCTTGTAGG + Intronic
1101481239 12:105099562-105099584 TTGGATCTCACACATTTTGTAGG + Intergenic
1105765322 13:23553519-23553541 TAGGATCATACTGTTTTTTTTGG - Intergenic
1106779083 13:33038490-33038512 TTGGATCTTACAGTTTTTTTGGG + Intronic
1107206396 13:37795238-37795260 TTGGATCAGGATGATTTTGCAGG + Intronic
1108752104 13:53458358-53458380 TTTGTTCATATTAATTTTGTGGG - Intergenic
1109106932 13:58264653-58264675 TTGGCTCATTCTGAGTTTGGGGG + Intergenic
1110102557 13:71627772-71627794 TTGCATCTTAGAGATTTTGTAGG - Intronic
1110176231 13:72559317-72559339 TGGGATCATACTAAATTTATGGG - Intergenic
1111834058 13:93365323-93365345 TTTGATCAACCTGATTTGGTAGG + Intronic
1112674736 13:101687763-101687785 TTGGATGATATTGATGATGTTGG + Intronic
1113083296 13:106539909-106539931 TTGGATGATTCTCATTTTCTAGG - Intergenic
1116158677 14:41238902-41238924 TTGGATCAGCCTGAATTTATTGG - Intergenic
1119459375 14:74787149-74787171 TTATGTCTTACTGATTTTGTAGG + Intronic
1123077245 14:105673722-105673744 ATGGGTCTTGCTGATTTTGTGGG + Intergenic
1124369070 15:29093171-29093193 TTGCATCATTCTGATGTTTTTGG - Exonic
1125125611 15:36216617-36216639 TTATATCAAACTGATTTTTTTGG - Intergenic
1127665011 15:61137445-61137467 GTGCATTATACTAATTTTGTAGG - Intronic
1130417637 15:83708762-83708784 TTGGATCATTCTGATTATTGAGG + Intronic
1133382135 16:5340031-5340053 CTGGCCCATACTGATTTTGCTGG - Intergenic
1135693243 16:24562585-24562607 TTGGAGCATAATTATTATGTAGG + Intronic
1139026540 16:62824819-62824841 TGGGACCATACTGATTTGGAAGG - Intergenic
1139334991 16:66225493-66225515 TTAGATCAAAGTGATTTTGTAGG + Intergenic
1139726189 16:68900877-68900899 ATGGATCATAATGACCTTGTGGG + Intronic
1147351457 17:39849327-39849349 TTTTTTCATACTGATTTTGTGGG - Intronic
1150023547 17:61647006-61647028 TTGTATAATAGGGATTTTGTGGG - Intergenic
1150598917 17:66633068-66633090 TCTGACCATACTGATCTTGTTGG - Intronic
1151163928 17:72188273-72188295 TTTGATGATCCTGATTTTATAGG + Intergenic
1155936804 18:31763029-31763051 CTGGATCCTGCTGATTTTGGGGG + Intergenic
1156210417 18:34934461-34934483 TTGCAACATACAGATTTTATTGG - Intergenic
1159858288 18:73615444-73615466 ATGGAGCATACAGATTTTATGGG + Intergenic
928348960 2:30529229-30529251 GTGGATTAAAATGATTTTGTTGG + Intronic
929173178 2:38951870-38951892 TTGGATCATATTTTCTTTGTAGG - Intronic
930708707 2:54529784-54529806 TTGGATGATCCCAATTTTGTTGG - Intronic
934110755 2:88739986-88740008 TTGGCTTATACTCATTTTCTTGG + Intronic
935338118 2:102035522-102035544 TGGGAGCATATTTATTTTGTTGG - Intergenic
940158653 2:150687446-150687468 TTGGATTTTACTGATTGTGATGG - Intergenic
941813234 2:169775022-169775044 TGGGAACATACAAATTTTGTGGG - Intronic
943910322 2:193557194-193557216 TTGTTTAATTCTGATTTTGTGGG + Intergenic
944270179 2:197774174-197774196 TTGAATAAAACTGATTCTGTAGG - Exonic
946099544 2:217307697-217307719 TTGGATCATACTGAATTTGTGGG + Intronic
946458323 2:219847827-219847849 TTCCATCACCCTGATTTTGTGGG + Intergenic
1169702639 20:8465297-8465319 TTGCATCATACTACTTTTGTAGG - Intronic
1170061950 20:12268542-12268564 CTGGCACATACTGAATTTGTAGG - Intergenic
1170343500 20:15355879-15355901 TTAGATCATAATTATTTTATAGG - Intronic
1170975950 20:21164896-21164918 TTTGAGCCTACTGATTTTCTGGG + Intronic
1171048800 20:21836640-21836662 TTGGATACCACTGATGTTGTTGG + Intergenic
1173288169 20:41691473-41691495 CTGCCTCCTACTGATTTTGTGGG - Intergenic
1173344353 20:42185021-42185043 TTGGACCATGCTGGTTTTCTAGG - Intronic
1173998015 20:47354310-47354332 TTGCATAATACTGTGTTTGTTGG - Intronic
1175513578 20:59552848-59552870 CTGGATTATACTGAATATGTAGG - Intergenic
1175566382 20:59981289-59981311 TGGGATCATGCTGACTTTATAGG + Intronic
1177600444 21:23304034-23304056 TTACATCATATTGATTTTGGGGG - Intergenic
1184110784 22:42393252-42393274 CTGGTTCTTACTGATTTTTTTGG - Intronic
1185263005 22:49880789-49880811 TGGGATCATATTGAATTTATAGG + Intronic
949426018 3:3916900-3916922 TTGGATAATACTGAAGTGGTAGG + Intronic
956276750 3:67510353-67510375 TTTAATCATACTCATTATGTGGG - Intronic
957351804 3:79033216-79033238 TTGGACCATACATATCTTGTTGG - Intronic
959787001 3:110311495-110311517 TTCCATCATCCTGAATTTGTGGG - Intergenic
960454336 3:117852114-117852136 TTGGCTCATCCTGATTTTCAAGG - Intergenic
962305371 3:134281444-134281466 TTGAATCATTCAGATTTTGGTGG - Intergenic
963104139 3:141631220-141631242 TTGAATCATACAGATTTTTGTGG + Intergenic
964924367 3:161937808-161937830 TTGGATTATACTGGATATGTAGG + Intergenic
965108148 3:164385657-164385679 TTGCATCATACTGATGTTTGGGG - Intergenic
965265960 3:166543749-166543771 TTTGATCTTACAGATTTTGGTGG + Intergenic
966656140 3:182360586-182360608 TGGGATAATACAGATTTTATGGG - Intergenic
966873355 3:184306856-184306878 TTGGAATATACTGGTTTTGATGG + Intronic
967701856 3:192602421-192602443 TTGGATCCTTCTCATTTTTTAGG - Intronic
970591472 4:17563926-17563948 TTGGAAAATACTGAGTTTGGTGG + Intergenic
972791035 4:42371299-42371321 TTTGTTCACAATGATTTTGTGGG - Intergenic
974593653 4:63988484-63988506 TAGGATGATACTGGGTTTGTGGG - Intergenic
976568281 4:86577685-86577707 TTGGATTATATTAATTTTCTTGG - Intronic
976956078 4:90902236-90902258 TTGGATCACACTGAATTTCCTGG + Intronic
977243467 4:94602384-94602406 TTGGGTCATCCAGATTTTGATGG - Intronic
978719209 4:111887020-111887042 TTGGATCTTAGCGATTTGGTGGG - Intergenic
978788204 4:112633747-112633769 TTGGATAAAACTGTTTTTGTGGG + Intronic
979716137 4:123841023-123841045 TAGTATTATACTGGTTTTGTAGG + Intergenic
980627851 4:135397250-135397272 TTGGATCATCTTTATTTTGTGGG + Intergenic
982574402 4:157090720-157090742 TTGGAAAATACTGATTCTCTGGG + Intronic
985036300 4:185843179-185843201 TTGAATCATCCTCCTTTTGTGGG - Intronic
985261547 4:188119240-188119262 TGGGATCATTCTGAGTTTTTTGG + Intergenic
988908027 5:35810020-35810042 TCAAGTCATACTGATTTTGTGGG - Intronic
989099769 5:37812955-37812977 TTGGATCCTACAGCTTTTTTGGG + Intronic
990214576 5:53515777-53515799 TTTTATCATACTAATTTTATGGG - Intergenic
991308162 5:65203718-65203740 CATGATCATCCTGATTTTGTGGG - Intronic
991675825 5:69089121-69089143 CTGGATTATACTGGTTATGTAGG - Intergenic
992616290 5:78548943-78548965 TTGGGTGATACTGCTTATGTTGG + Intronic
993985404 5:94591572-94591594 TTGGATAACACTGATTTTACTGG - Intronic
994605705 5:101963377-101963399 TTTTATTATACTGATTTTATTGG + Intergenic
994734609 5:103537084-103537106 TTGGATGATAAAGATTTTTTTGG + Intergenic
995678089 5:114685868-114685890 TTGGATAACAATGAATTTGTTGG + Intergenic
996216301 5:120870866-120870888 TTGGATCATATTCATTGTATGGG - Intergenic
996462364 5:123760950-123760972 TTTGATCATAATGATTTAGAGGG - Intergenic
1000249082 5:159476426-159476448 ATGGATCATACTACCTTTGTGGG - Intergenic
1000836057 5:166155721-166155743 TTGGATCTCCCTGATTTTGAAGG - Intergenic
1001782379 5:174381182-174381204 TTTGCTCATGCTGGTTTTGTGGG + Intergenic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1004984767 6:21068766-21068788 TAAGATCATATTGATTTTATAGG + Intronic
1007188009 6:39988926-39988948 TTGGATGATACTGATTTTGTTGG + Intergenic
1008465296 6:51823364-51823386 ATGGATCATAGTAATTTTCTAGG - Intronic
1011181193 6:84622783-84622805 TTAAAGCATACTGTTTTTGTAGG + Intergenic
1011467121 6:87669592-87669614 TTTGATCATATTCATTTGGTGGG - Intergenic
1011887801 6:92119274-92119296 TTGGAGCAGACTGATTTTAGGGG + Intergenic
1012239364 6:96854568-96854590 TTGGGACATACTCCTTTTGTTGG + Intergenic
1012776922 6:103508109-103508131 ATAGATCATTCTGATTTTGTGGG + Intergenic
1013114627 6:107093063-107093085 TGGGATCATACTGAATCTATAGG - Intronic
1013292100 6:108728619-108728641 AAGAATCATTCTGATTTTGTGGG - Intergenic
1014190127 6:118486530-118486552 TTGGATCATATTGTTTCTTTTGG - Intronic
1014706921 6:124759070-124759092 TTGTATCATGTTGATTTTATTGG + Intronic
1015015711 6:128410328-128410350 TTGGATGATTCTCGTTTTGTGGG - Intronic
1016356385 6:143223258-143223280 TTGGAACGTTCTGATTTTGTAGG - Intronic
1016411926 6:143792539-143792561 TTATATCTTACAGATTTTGTAGG + Intronic
1018123265 6:160657766-160657788 TTGGATCAAGCTGAATTTATTGG - Intronic
1018965916 6:168488792-168488814 TTGGATCACACTGTTTTAGAGGG + Intronic
1018965944 6:168489034-168489056 TTGGATCACACTGTTTTAGAGGG + Intronic
1018965973 6:168489277-168489299 TTGGATCACACTGTTTTAGAGGG + Intronic
1018966049 6:168489959-168489981 TTGGATCACACTGTTTTAGAGGG + Intronic
1018966057 6:168490008-168490030 TTGGATCACACTGTTTTAGAGGG + Intronic
1019296303 7:277305-277327 TTGGAGGATACAGATTTTGAGGG - Intergenic
1021013879 7:15507866-15507888 TTGCTTCACACTAATTTTGTGGG + Intronic
1022701656 7:32766590-32766612 TTGGAGCTTACTTATTTTCTAGG + Intergenic
1024366309 7:48524568-48524590 TCTGCTCCTACTGATTTTGTAGG - Intronic
1028372883 7:90114431-90114453 TTGGAGCTTACTTATTTTCTAGG - Intergenic
1029833403 7:103283814-103283836 TTGGAGCTTACTTATTTTCTAGG + Intergenic
1030198038 7:106872212-106872234 TTAGGTCTTACTGGTTTTGTTGG - Intronic
1030363371 7:108619051-108619073 ATGGAATATACTGATTTTGTTGG + Intergenic
1031054067 7:116974681-116974703 TTGTATCATCCTGCATTTGTAGG + Intronic
1031552566 7:123133109-123133131 AGGGATCTTACTGATTTTCTGGG + Intronic
1033499580 7:141934468-141934490 TTTGAACATAGTGAGTTTGTGGG + Intronic
1033813862 7:145049311-145049333 GTGGATTATACTGAATCTGTAGG + Intergenic
1034131675 7:148724266-148724288 TTGTTTCATATTGATTCTGTTGG + Intronic
1035334249 7:158115472-158115494 TTGGAACATACAGATTTTAGGGG - Intronic
1035974017 8:4286658-4286680 AGCAATCATACTGATTTTGTAGG + Intronic
1035985700 8:4429567-4429589 TTGGTCCATACTGATTTAGGAGG + Intronic
1037048335 8:14337668-14337690 ATAGATCATACTCATTTGGTAGG - Intronic
1041329487 8:56709082-56709104 TTCAAACATACTGATTTTCTAGG + Intergenic
1041563307 8:59246039-59246061 TTGGATCAGTCAGATTTTGCTGG + Intergenic
1041778641 8:61553354-61553376 AAGTATCATACTAATTTTGTGGG - Intronic
1041993448 8:64024417-64024439 TTGGATCATTTTCATTTTTTGGG - Intergenic
1043027056 8:75083264-75083286 TTGGAGATTACTGATTTTGGAGG - Intergenic
1043573346 8:81629987-81630009 TTAGATCATACAGATTTTGTGGG - Intergenic
1043578383 8:81683830-81683852 TTGGATCATACTGATTTTGTGGG - Intronic
1044157819 8:88871940-88871962 TTGGTTCTTTCTGATTTTCTTGG + Intergenic
1044328494 8:90888957-90888979 ATGGATCATACTCACTTTTTAGG + Intronic
1044902323 8:96960098-96960120 TTGAGTCATACTTATTTTCTTGG - Intronic
1044915702 8:97110862-97110884 TCGGATCATATTGATTTGGTTGG - Intronic
1045585832 8:103536126-103536148 TTGGTTCAGACTTATTTTCTGGG + Intronic
1046651169 8:116838146-116838168 ATGGCTCACAATGATTTTGTTGG - Intronic
1047334360 8:123921792-123921814 TTGGATCTTACTGATGATGATGG + Intronic
1048133712 8:131725217-131725239 TTGTATCTTCCTGATGTTGTGGG - Intergenic
1048320588 8:133396797-133396819 GTAGAACATACTGATTGTGTTGG + Intergenic
1049549007 8:143247756-143247778 TTGGACCATAGCGATTTTCTTGG - Intronic
1049634341 8:143678768-143678790 CTGGATTATACTGAATGTGTGGG + Intergenic
1050649582 9:7761058-7761080 TTGAATCATACTGCTTCTATAGG + Intergenic
1058927493 9:109681795-109681817 CTAGATGATAATGATTTTGTAGG + Intronic
1059448283 9:114353040-114353062 TCAGATCATACTGAGTTTCTTGG + Intronic
1186158241 X:6748384-6748406 TTGGATCTGACTGATTTTGATGG - Intergenic
1187142736 X:16609667-16609689 TCAGATCATCCTTATTTTGTTGG - Exonic
1187729258 X:22235962-22235984 TTGGATCATACTGAAAATTTGGG - Intronic
1188233353 X:27694458-27694480 TTCTATCAAACTGATCTTGTTGG + Intronic
1188309867 X:28603119-28603141 TTGGATCATACTGGAGTTGTAGG + Intronic
1188310023 X:28604952-28604974 TTGGATCATACTTGACTTGTGGG + Intronic
1188706243 X:33335422-33335444 ATAAATCTTACTGATTTTGTTGG - Intronic
1189866505 X:45335525-45335547 TTGGATCATATTAAGTTTCTGGG - Intergenic
1191917613 X:66219831-66219853 CTGGATTATACTGGATTTGTGGG - Intronic
1193277624 X:79607892-79607914 TTGTAACTTACTGATTTTGATGG - Intergenic
1194333915 X:92620836-92620858 TTGGAGCATACTGGTTTTCCAGG + Exonic
1194594401 X:95839021-95839043 TTGTATGATGCTGATTTTGGGGG - Intergenic
1200311395 X:155081877-155081899 CTGGACCTTAATGATTTTGTTGG + Intronic
1200642600 Y:5739832-5739854 TTGGAGCATACTGGTTTTCCAGG + Intronic