ID: 1043578445

View in Genome Browser
Species Human (GRCh38)
Location 8:81685800-81685822
Sequence GTGACCAGGACAGAAACAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 2, 1: 0, 2: 2, 3: 28, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043578445_1043578447 -7 Left 1043578445 8:81685800-81685822 CCTGCTGTTTCTGTCCTGGTCAC 0: 2
1: 0
2: 2
3: 28
4: 244
Right 1043578447 8:81685816-81685838 TGGTCACAGCCTTCCAGCGTAGG 0: 1
1: 0
2: 0
3: 21
4: 342
1043578445_1043578448 0 Left 1043578445 8:81685800-81685822 CCTGCTGTTTCTGTCCTGGTCAC 0: 2
1: 0
2: 2
3: 28
4: 244
Right 1043578448 8:81685823-81685845 AGCCTTCCAGCGTAGGAGCCAGG 0: 1
1: 0
2: 0
3: 13
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043578445 Original CRISPR GTGACCAGGACAGAAACAGC AGG (reversed) Exonic
900250392 1:1665746-1665768 GTCACGAGGACAGCAGCAGCTGG + Exonic
901403419 1:9030336-9030358 ACCACCAGGACAGAAACATCAGG - Intergenic
901731735 1:11284999-11285021 ATGAGCAGGACAGAAACAGGAGG + Intronic
902878206 1:19353476-19353498 GTGGCAAGGGCAGAAACAGAAGG - Intronic
905768328 1:40621720-40621742 GTGATCTGGACAGGGACAGCTGG - Exonic
912222026 1:107689312-107689334 GACATCAGGACAGAAAGAGCAGG + Intronic
912869816 1:113293842-113293864 GCAACCAGGACAGAACCAACAGG + Intergenic
919297562 1:195721815-195721837 CTTACCAGGACCGAAACAGGTGG + Intergenic
920135513 1:203765969-203765991 GTCACCATGACAGAAACAAAAGG + Intronic
921353573 1:214262913-214262935 GTGACCAGAAGAGAAACAAGTGG - Intergenic
921466155 1:215490692-215490714 ATGACCAGCACAGATACAACTGG - Intergenic
922915980 1:229258133-229258155 GTGACAAGGCCAGCACCAGCAGG - Intergenic
923713713 1:236407199-236407221 GTGTCCAGCACAGAAACAGAGGG - Intronic
924167178 1:241296148-241296170 GAGACCAGGAAAGGAAGAGCAGG + Intronic
924953456 1:248906477-248906499 GGGACCAGGACAGGAACAATGGG + Intronic
1063167360 10:3475612-3475634 GTGCCCAGGATGGACACAGCCGG - Intergenic
1063584638 10:7340850-7340872 GTAACTGGGACAGAAACTGCAGG + Intronic
1067038392 10:42935185-42935207 CAGAGCATGACAGAAACAGCAGG - Intergenic
1067057987 10:43063498-43063520 ATCACCAGGACAGCAACAGGGGG + Intergenic
1070628206 10:78066230-78066252 GTGCCCAGGACAGGAACAACTGG + Intergenic
1070997305 10:80797010-80797032 GTGACCAGGAGAAGGACAGCTGG - Intergenic
1071070800 10:81691214-81691236 GTGACCAGGAGTAAAACTGCTGG + Intergenic
1071783425 10:88872850-88872872 TTTACCAGGACTGAATCAGCAGG + Intergenic
1072102434 10:92241405-92241427 GTGACCAAGACAGCAGCAGGAGG - Intronic
1072166333 10:92817040-92817062 TTGACCTGGAGAGAAAGAGCAGG + Intergenic
1074701386 10:116095773-116095795 GTGACCCTGACACAGACAGCCGG + Intronic
1076138977 10:128064591-128064613 GAGACCAGCACAGAAGCAGTGGG + Intronic
1077138535 11:1013350-1013372 GTGACCAGGAAAGCAGCTGCTGG + Exonic
1078253645 11:9638959-9638981 CTTACCAGGGCAGAAACAACAGG + Intergenic
1079080121 11:17408196-17408218 GTGCCCAGGGCAGAATCAGGTGG - Intronic
1081673222 11:44953305-44953327 GGGACCAGGGGAGAAGCAGCTGG + Intergenic
1083949235 11:65944918-65944940 GTGTCCAGGAGAGAGGCAGCAGG - Intergenic
1084378944 11:68798416-68798438 GCGACCCTGACAGAACCAGCAGG - Intronic
1084569597 11:69951480-69951502 GGGGCCAGGACAGAAACATTCGG - Intergenic
1084959715 11:72710082-72710104 GTGCCCAGGAGGGAGACAGCAGG + Intronic
1087230001 11:95650454-95650476 GTGACAACCAAAGAAACAGCTGG + Intergenic
1088755843 11:112884577-112884599 GGGACCCGCACAGAAACAGAGGG - Intergenic
1089166851 11:116483972-116483994 GTGACCAAGACTGAAGCAGTTGG + Intergenic
1089385649 11:118065928-118065950 GTGACCAGGCTAGAATCAGGAGG + Intergenic
1089393383 11:118117276-118117298 GAGACCAGAACAGAGACTGCTGG - Intronic
1091689793 12:2588155-2588177 TTGACCAGAACAGAGACAACAGG - Intronic
1092208495 12:6631430-6631452 GTGACCACGACACACACAGAGGG + Intronic
1092238054 12:6821996-6822018 TTCTCCAGGGCAGAAACAGCAGG - Intronic
1093987796 12:25556537-25556559 GAGACCAGACCAGAAAAAGCAGG - Intronic
1094633433 12:32200343-32200365 CCGACCAGGACAGAGATAGCTGG + Intronic
1096420216 12:51450858-51450880 GTGACCTGGAAAGAAGCAGAAGG - Exonic
1096766063 12:53890839-53890861 GAGACAAGGACAGAACCAGGAGG - Intergenic
1096879425 12:54655360-54655382 ATGACCAGGAAAGAAGCTGCTGG + Intergenic
1097696937 12:62784055-62784077 GGGACCAGGAAAGAAGCAGATGG - Intronic
1102051612 12:109866303-109866325 TGGCCCAGGTCAGAAACAGCAGG - Intronic
1102523446 12:113493853-113493875 GTGAGCAAGAGAGAGACAGCTGG - Intergenic
1102957131 12:117066068-117066090 GAGACCAGGAGAGAAGGAGCCGG - Intronic
1104496949 12:129249903-129249925 GTGACAAGGGCAGGAACAGCAGG + Intronic
1104672145 12:130688281-130688303 GTGAGGAGTTCAGAAACAGCAGG - Intronic
1105960577 13:25332148-25332170 GTGAACAGAACAGCAAGAGCAGG + Intronic
1108410905 13:50145862-50145884 GTGAAAAAAACAGAAACAGCCGG - Intronic
1110259043 13:73464660-73464682 GAGACCAGGAAAAAAAAAGCTGG + Intergenic
1113160707 13:107377362-107377384 GTGACTAGTGTAGAAACAGCAGG - Intronic
1114570609 14:23664753-23664775 GTGACCAGGATAGAGCCTGCTGG - Intergenic
1114998538 14:28391463-28391485 GTGACAAGGACAGAGCCAGGTGG + Intergenic
1115961842 14:38842812-38842834 GTGACTATGGCAGAAACTGCTGG - Intergenic
1116342035 14:43736186-43736208 ATGACCAGAAAAGAAACTGCTGG - Intergenic
1117211853 14:53509119-53509141 GTGAACATGTCAGAAACACCAGG - Intergenic
1117220778 14:53603143-53603165 ATGACAAGGACATAAACATCAGG - Intergenic
1117318915 14:54602017-54602039 GAAAGCAGGACAGAAACAGCAGG + Intronic
1117407064 14:55414310-55414332 AAGCCCAGCACAGAAACAGCTGG - Exonic
1118371797 14:65143944-65143966 GTGAACAGGACAGGAAAAGAGGG + Intergenic
1118570144 14:67186688-67186710 GTGACACTGACAGAAACAGCAGG + Intergenic
1121080454 14:91103651-91103673 GAGAGAAAGACAGAAACAGCAGG - Intronic
1121247593 14:92473496-92473518 GTTACGAAGACAGAAACAGCAGG - Intronic
1121621933 14:95356273-95356295 GTCACCAGGACAGGACCAGCAGG + Intergenic
1122163984 14:99807503-99807525 GTGGCCAGGACTGGTACAGCAGG + Intronic
1122412852 14:101534781-101534803 GTGTCCAGGACAGGGACACCGGG + Intergenic
1122480839 14:102046392-102046414 GTTAACAGGACAGAATCAGGAGG + Intronic
1123070107 14:105638517-105638539 GTGGCCGGCACAGACACAGCGGG + Intergenic
1202832842 14_GL000009v2_random:56016-56038 GTGTCCAATACAGCAACAGCTGG - Intergenic
1123404683 15:20012660-20012682 GTGGCCAGCACGGACACAGCGGG - Intergenic
1123514016 15:21019307-21019329 GTGGCCAGCACGGACACAGCGGG - Intergenic
1130521796 15:84667501-84667523 GTGACCAGTACACAAGCAACAGG + Intergenic
1131375752 15:91921635-91921657 GTTACCATGACATCAACAGCAGG - Intronic
1132463377 16:66558-66580 GGGACCAGAACAGACACAGGTGG + Intronic
1133228467 16:4354750-4354772 TTGACCAGAACTGGAACAGCAGG + Exonic
1133739237 16:8639383-8639405 GTGTCCGGGAGAGAAAGAGCTGG - Intronic
1134048779 16:11122150-11122172 GAGAGCAGGACACAGACAGCAGG - Intronic
1135076928 16:19401900-19401922 CTTACCAGGACTGAAACAGGTGG + Intergenic
1138933917 16:61695521-61695543 GTGCTCAGGACAGAATCTGCAGG - Intronic
1139593352 16:67945009-67945031 GTGCCCAGGAGAGAAGCCGCTGG + Intronic
1140033056 16:71353807-71353829 GTCACCAGGATAGCAACAGGAGG - Intergenic
1140403531 16:74691641-74691663 GTGACCAGTAGAGACACAGCTGG + Intronic
1140896483 16:79329141-79329163 GGGACCAGGCAAGAAACACCAGG + Intergenic
1140928613 16:79606679-79606701 TTGAACAGGACAGAAATAGAAGG + Intergenic
1142025079 16:87808244-87808266 GTGACCAAGACTGAAAAACCCGG + Intergenic
1142903347 17:3026805-3026827 GTCAGCAGGAAAGAAAGAGCAGG + Intronic
1142991226 17:3732408-3732430 ATGATCAGGACAGAAGCAACCGG + Exonic
1143039429 17:4022608-4022630 GTGCACAGGGCAGAAGCAGCTGG + Intronic
1143153002 17:4818661-4818683 GGGATCAGGACAGAATCAGGAGG - Intronic
1147170738 17:38617342-38617364 GGGAAGAGGACAGACACAGCTGG - Intergenic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1150007203 17:61477164-61477186 CTGGCCAGGACAGAAACCGAAGG + Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150609978 17:66726218-66726240 GTGTGCAGGACAGAAAGCGCAGG + Intronic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1151802851 17:76387857-76387879 GTCACCAGGACAGGACGAGCAGG - Intronic
1152535976 17:80950586-80950608 GAGATCAGGACAGAAGCAACAGG - Intronic
1155246776 18:23918440-23918462 CAGATCAAGACAGAAACAGCAGG - Intronic
1156268455 18:35509231-35509253 GTGAGCAAGAAAGAAGCAGCAGG - Intergenic
1158444236 18:57504909-57504931 GTGTCCAGGACAGGCAGAGCGGG + Intergenic
1159061926 18:63523834-63523856 TTCTCAAGGACAGAAACAGCAGG + Intergenic
1162918057 19:13884819-13884841 GTGACCAAGGCAGGAGCAGCAGG - Intronic
1163805366 19:19393532-19393554 GTGAGCAGGACTGACACAGCTGG + Intronic
1166465582 19:43027827-43027849 GTGAACAGGACAGATGGAGCAGG + Intronic
1166496610 19:43307451-43307473 CTCACCAGGACTGAATCAGCTGG - Intergenic
1166590353 19:43992306-43992328 CTTGGCAGGACAGAAACAGCAGG - Intronic
1167148230 19:47694987-47695009 CTGACCAGCACAGACGCAGCGGG - Exonic
1167498437 19:49832203-49832225 GGGAACAGGAAAGAGACAGCAGG - Intronic
1202639842 1_KI270706v1_random:71708-71730 GTGTCCAATACAGCAACAGCTGG + Intergenic
925156431 2:1651775-1651797 GTGACCCAGAGAGAAACAGCAGG - Intronic
925245578 2:2379655-2379677 ATGACTGGGACTGAAACAGCTGG - Intergenic
926291520 2:11534939-11534961 GTGCTCAGGACAGAATCAGCTGG + Intronic
928304035 2:30151023-30151045 GTGGGCAGTACAGAAACAGGTGG + Intronic
929578588 2:43068055-43068077 GAGACCAAAAGAGAAACAGCCGG + Intergenic
930000661 2:46859619-46859641 GTGACCAGGGCAGAATCTCCTGG + Intergenic
931828213 2:66023489-66023511 CTGACCAGGACAGTAGCAACAGG + Intergenic
934495319 2:94791125-94791147 GTGTCCAACACAGCAACAGCTGG + Intergenic
935758429 2:106296522-106296544 ATGAGCAGGACAGAAATAGCTGG - Intergenic
937211857 2:120278839-120278861 AGGACCGGCACAGAAACAGCGGG - Intronic
940005912 2:149009530-149009552 ATGGCCAGGACATAAAGAGCTGG + Intronic
940050888 2:149463512-149463534 GTGACCAGAAGTGAAACTGCTGG - Intronic
940117774 2:150228053-150228075 GTGTGCAGAACAGAAAAAGCAGG + Intergenic
940240755 2:151560770-151560792 GTGAGAAGGACAGACACAGAAGG - Intronic
944911982 2:204319322-204319344 GAGACCAGAAAAGAATCAGCTGG + Intergenic
944916424 2:204365174-204365196 GTGACCAGGGTTGAAACATCAGG - Intergenic
946229279 2:218281784-218281806 GTAACAAAGACAGAAACAGAGGG + Intronic
946903418 2:224393992-224394014 GAGACCAGGACAGAACCTGAAGG + Intronic
947393352 2:229662703-229662725 CTGACCAGAACAGACACACCAGG + Intronic
1168984005 20:2032068-2032090 GTGAGCAGCAGGGAAACAGCAGG - Intergenic
1169532630 20:6502042-6502064 GGAACCAGAACAGAAACAGAAGG + Intergenic
1169948810 20:11019081-11019103 GTGACCAGAGCAGAACAAGCTGG + Intergenic
1171886504 20:30656059-30656081 GTGTCCAACACAGCAACAGCTGG + Intergenic
1172433745 20:34913932-34913954 GGGACCAGGAGAGAAAAGGCAGG - Intronic
1172992636 20:39047762-39047784 GTGACCAGGACCTAAGCAGAGGG + Intergenic
1175746845 20:61462979-61463001 GTGTCAAGGACAGAACCAGGTGG + Intronic
1175900011 20:62356274-62356296 GCGACCAGGTCAGAGACAGATGG - Intronic
1175962431 20:62643770-62643792 ATGACAAGGACAGTGACAGCAGG + Intronic
1176648171 21:9369308-9369330 GTGTCCAATACAGCAACAGCTGG + Intergenic
1177179975 21:17734525-17734547 GGTACCAGGACAAAAACAGGAGG - Intergenic
1177732065 21:25040211-25040233 GAGACAATGACAGAAACAGGTGG + Intergenic
1179180972 21:39044973-39044995 GTGATCAGGACAGATACATTTGG + Intergenic
1179713521 21:43276090-43276112 GTCCCCAGCACAGAGACAGCAGG + Intergenic
1179713561 21:43276249-43276271 GTCCCCAGCACAGAGACAGCAGG + Intergenic
1179713575 21:43276312-43276334 GTCCCCAGCACAGAGACAGCAGG + Intergenic
1179713588 21:43276375-43276397 GTCCCCAGCACAGAGACAGCAGG + Intergenic
1180362098 22:11910162-11910184 GTGTCCAGTACAGCAACAGCTGG - Intergenic
1181464093 22:23101562-23101584 TTGACCAGGTCAGGAACAGGAGG - Intronic
1181581980 22:23833682-23833704 GCGACCAGGACAGGAACACGAGG + Exonic
1182489939 22:30664842-30664864 GGGACAAGCACAGAGACAGCAGG + Intronic
1183649221 22:39144796-39144818 ATGACCACTACAGTAACAGCAGG + Intronic
1183723947 22:39578214-39578236 GTGACCAGGGCAGGGACAGCAGG - Intronic
1184778099 22:46633263-46633285 GTGACAAGGACAGACAATGCTGG - Intronic
1184872037 22:47246929-47246951 GTGACCAAGACAGCACCATCAGG + Intergenic
1184965900 22:47972102-47972124 GTGACCAGGACCAACACAGCAGG - Intergenic
1185190751 22:49434350-49434372 GTGACGAGGACAGCTTCAGCCGG - Intronic
949502130 3:4690467-4690489 TTGACAAGGATAGGAACAGCTGG + Intronic
950314955 3:11993542-11993564 GTGTCCAGGACAAATGCAGCTGG - Intergenic
950613537 3:14141112-14141134 GTGCCCAGCACTGAACCAGCAGG - Intronic
951045332 3:18031396-18031418 GTGACTAAGGCAGACACAGCTGG - Intronic
951471638 3:23062735-23062757 GTGCCCAGGACAGACATTGCTGG - Intergenic
952845268 3:37682933-37682955 GTGGCCAGGAGAGGAACAGGGGG - Intronic
953017729 3:39094437-39094459 GTGACTATGCCAGAAACACCAGG - Intronic
953316705 3:41934398-41934420 GTGCCAAGGAAAGAAAAAGCTGG - Intronic
954007632 3:47604645-47604667 GTTACCAGTTCAGAAAAAGCTGG - Intronic
959021562 3:101192838-101192860 ATCACCAGGAGAGAAACAGATGG - Intergenic
960156580 3:114302477-114302499 GTGCCCAGGAGAGATACAGCTGG - Intronic
961008670 3:123422017-123422039 GTGGCCAGGGGAGAAACACCGGG - Intronic
961328559 3:126125876-126125898 GCATCCAGGACAGAAACAGCAGG - Intronic
961554003 3:127685262-127685284 GTGACCAGGGCAGAACAAGGTGG - Intergenic
962230490 3:133661667-133661689 GTTACCAGGACAGGAAAAGAGGG + Intronic
962352812 3:134668005-134668027 GTCACCAGGGCAGATACATCTGG - Intronic
963587454 3:147210541-147210563 GTTACTAGTACAGAAACAGATGG + Intergenic
966301042 3:178480101-178480123 GTGACCAGGACTCCTACAGCAGG - Intronic
968001189 3:195207974-195207996 GTGCCCAAGACAGAAGCAGCAGG + Intronic
1202738715 3_GL000221v1_random:35679-35701 GTGTCCAATACAGCAACAGCTGG - Intergenic
968661473 4:1800520-1800542 GAGTCCATGAGAGAAACAGCTGG + Intronic
968725817 4:2247398-2247420 GTGACAACCACAGAAAGAGCCGG + Intergenic
969226960 4:5804973-5804995 GAGACCAGGACAGAGGCAGCGGG - Intronic
969334659 4:6500646-6500668 GTGACCAGGAAGGAAAGAGGGGG + Intronic
969397436 4:6931520-6931542 GTGTCCAGCACATACACAGCTGG - Intronic
971058351 4:22938997-22939019 GTGACCAGGTGAGAAAAAGGAGG - Intergenic
973532534 4:51847190-51847212 GAGACCAAGCCAGAGACAGCTGG - Intronic
973913979 4:55614202-55614224 GTGGATAGGACAGAAACAGGAGG - Intronic
974083280 4:57234297-57234319 GTGTACAGAAAAGAAACAGCAGG + Intergenic
974360113 4:60866442-60866464 GTGACTAGCACAGAAACAGCTGG - Intergenic
977859719 4:101942106-101942128 GTCAGCAGGACTGAAACATCTGG + Intronic
978979821 4:114929476-114929498 GAGACCAGGACAGACACAGCAGG - Intronic
979314196 4:119241099-119241121 ATGAAAAGGACAGAAACAGAGGG - Intronic
979525232 4:121709115-121709137 TTAACCAGGACAGGAACTGCGGG - Intergenic
980084854 4:128380521-128380543 ATGAGCAGGGCAGGAACAGCTGG - Intergenic
980688303 4:136259141-136259163 GTGACCATGACATTAATAGCTGG - Intergenic
981533599 4:145776509-145776531 GTGTCCAGGAAAAAAAAAGCAGG - Intronic
984660917 4:182374292-182374314 GTGGCCAAGAAAAAAACAGCAGG - Intronic
1202767197 4_GL000008v2_random:157563-157585 GTGTCCAATACAGCAACAGCTGG + Intergenic
986270783 5:6228928-6228950 GTGATCACCACAGAAACATCTGG - Intergenic
986407804 5:7444041-7444063 GAGAACAGGACAAAAATAGCAGG - Intronic
988896421 5:35679211-35679233 GAGACCAGGACAGACCCAGCCGG + Intronic
989139575 5:38189476-38189498 GTGACCACGACAAAGACAGCAGG + Intergenic
989782524 5:45285661-45285683 GTGAAGAGGACAGAAACTGGTGG - Intronic
991453164 5:66774255-66774277 AAGACCAAGACAGAAACAGTGGG - Intronic
992142108 5:73808858-73808880 TATACCAAGACAGAAACAGCAGG - Intronic
993522945 5:88927292-88927314 GTGACCATCACAGAAAAGGCAGG + Intergenic
998416526 5:141950218-141950240 GGGACCAGGATGGAGACAGCAGG - Intronic
999110952 5:149121158-149121180 GTGACCTGAGCAGCAACAGCAGG + Intergenic
1001848446 5:174941845-174941867 TTGACCAGGGCGGAGACAGCTGG + Intergenic
1003528148 6:6915572-6915594 GTGAACAGTACATAAACAGGCGG + Intergenic
1003720129 6:8692674-8692696 ATGACTGGGACAGAAGCAGCTGG - Intergenic
1004783495 6:18939269-18939291 GTGACCAGGACAGGCCAAGCTGG + Intergenic
1004911232 6:20287122-20287144 GTGACCAGTGCACAACCAGCAGG + Intergenic
1006620348 6:35359581-35359603 GTGAAATGGAAAGAAACAGCGGG - Intronic
1006626895 6:35404021-35404043 GTGTTCTTGACAGAAACAGCTGG + Intronic
1007690505 6:43698100-43698122 GTGACCAGGAGACCAACATCAGG - Intergenic
1008595604 6:53039056-53039078 GTGACAAGGACAGAGTGAGCTGG - Intronic
1010771780 6:79840198-79840220 GTTACCAGCAAAGAACCAGCAGG + Intergenic
1012932590 6:105332256-105332278 GTGACCCCGAGAGAAGCAGCTGG + Intronic
1013087892 6:106872065-106872087 GTGTCCAGGGCAGAGGCAGCTGG - Intergenic
1015031149 6:128597505-128597527 GTAACCAGGAGTGAAACAGTGGG - Intergenic
1016036703 6:139390605-139390627 GTCAGCAGGACATAAACAACAGG - Intergenic
1016074099 6:139775705-139775727 GTCACCCAGACAGAAACACCAGG - Intergenic
1019802865 7:3101142-3101164 GTGAGCAGGACACACAAAGCTGG + Intergenic
1022272979 7:28828097-28828119 GTAATCAGTACAGAAACAACTGG + Intergenic
1023328311 7:39084778-39084800 GTGACCAGCACAGAAGCAGGTGG - Intronic
1025994328 7:66518611-66518633 GGGAGCAGGACAGAGGCAGCAGG - Intergenic
1026033669 7:66816052-66816074 GAGAGCAGGACAGAGCCAGCAGG + Intergenic
1026513004 7:71042898-71042920 CTGTCCATTACAGAAACAGCAGG + Intergenic
1026985938 7:74555300-74555322 GGGAGCAGGACAGAGGCAGCAGG - Intronic
1027171005 7:75872402-75872424 GTGACCAGGACTGGGACAGAGGG - Intronic
1027266846 7:76499201-76499223 GTGACCTGGAGGGAAACTGCTGG - Intronic
1027318663 7:76999061-76999083 GTGACCTGGAGGGAAACTGCTGG - Intergenic
1028172521 7:87615544-87615566 GAGCCAAGGGCAGAAACAGCTGG + Intronic
1029141927 7:98417487-98417509 TTGACCAGGACAGAGGGAGCTGG - Intergenic
1030176104 7:106656274-106656296 GTGAACAGCACAGCAAGAGCCGG - Intergenic
1031064281 7:117087924-117087946 GTGACAAAGACAGACACATCTGG - Intronic
1031129906 7:117820316-117820338 GTGCCCAGGGCAGAAATAGTGGG - Intronic
1031551157 7:123113923-123113945 ATGACAAGGTCAGTAACAGCTGG + Exonic
1032127001 7:129202571-129202593 GTCAGCAAGACAGAAACAGGCGG - Intronic
1033306256 7:140227944-140227966 GTTAGCAGGACAGAACCAGGAGG - Intergenic
1033766665 7:144500411-144500433 GTGCCAAGTACAGAAATAGCAGG - Intronic
1034577943 7:152017647-152017669 ATGATCAGGAAAGAAAAAGCAGG + Intronic
1035022204 7:155806488-155806510 GTGGCCAGGAGTGAAACTGCGGG - Exonic
1035350595 7:158243199-158243221 GTGATCAGAGCAGACACAGCAGG + Intronic
1037812980 8:22097687-22097709 AGCACCAGGACAGAAACAGAGGG - Intronic
1038146539 8:24902045-24902067 GTGAACAGGACAGCATCAGAAGG - Intergenic
1040462213 8:47659853-47659875 GTGACCTAGAATGAAACAGCCGG + Intronic
1041053779 8:53961813-53961835 GAGACTAAAACAGAAACAGCTGG - Intergenic
1043573411 8:81630483-81630505 GTGACCAGGACAGAAACAGCAGG - Intergenic
1043578445 8:81685800-81685822 GTGACCAGGACAGAAACAGCAGG - Exonic
1046005712 8:108480724-108480746 CTGAACAGGGCAGAAACACCAGG - Intronic
1047022887 8:120795423-120795445 GTGGTCAGGACAGAGAGAGCTGG - Intronic
1048743471 8:137587787-137587809 GTGACCAGACCAGGATCAGCTGG - Intergenic
1050062025 9:1719435-1719457 GTAACCAGGAAACAAACAGAAGG - Intergenic
1051149409 9:14064133-14064155 GTGAGCAGGACAGAACAAGCAGG + Intergenic
1051404781 9:16725456-16725478 GTGACCATGACAGAAAAAGGTGG + Intronic
1053135710 9:35649325-35649347 GGGGACAGGACAGAGACAGCAGG + Exonic
1057210171 9:93196819-93196841 GTAACCAAGACAGACACAGCAGG - Intronic
1058588519 9:106535739-106535761 GTGACCAAGACAGAGAAAGCTGG + Intergenic
1058998411 9:110322746-110322768 GGTACCAGGACAGAATCAGGAGG + Intronic
1060204566 9:121674945-121674967 ATCACCAGGACAAAAGCAGCTGG - Intronic
1062101330 9:134730209-134730231 GAGCCAAGGACAGAGACAGCTGG - Intronic
1062623176 9:137431659-137431681 GTGACCAGGAGTGACCCAGCTGG + Intronic
1203707445 Un_KI270742v1:66123-66145 GTGTCCAATACAGCAACAGCTGG - Intergenic
1203547949 Un_KI270743v1:142440-142462 GTGTCCAATACAGCAACAGCTGG + Intergenic
1187037679 X:15559214-15559236 GTGATCAGGCCAGAAATGGCAGG - Intergenic
1190688096 X:52891928-52891950 GTGACAAGGACATGAACACCTGG - Intronic
1190697886 X:52963864-52963886 GTGACAAGGACATGAACACCTGG + Intronic
1196648640 X:118146285-118146307 ATGACCAGGGCAGAGACAGAAGG - Intergenic
1197896353 X:131319637-131319659 ATGACCAGGACAGTAACAGAGGG - Intronic
1198708936 X:139480246-139480268 GTCAACAGGACTGAATCAGCAGG - Intergenic
1200080605 X:153574514-153574536 GTGCCCAGCACAGAGGCAGCAGG + Intronic