ID: 1043578569

View in Genome Browser
Species Human (GRCh38)
Location 8:81686391-81686413
Sequence GCAGGGCGCAGCTCGGGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 1, 2: 0, 3: 43, 4: 371}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043578569_1043578587 24 Left 1043578569 8:81686391-81686413 CCCCGCCCCGAGCTGCGCCCTGC 0: 1
1: 1
2: 0
3: 43
4: 371
Right 1043578587 8:81686438-81686460 TCCTGACCCGCGCTGGAGCATGG 0: 1
1: 0
2: 0
3: 5
4: 88
1043578569_1043578579 -4 Left 1043578569 8:81686391-81686413 CCCCGCCCCGAGCTGCGCCCTGC 0: 1
1: 1
2: 0
3: 43
4: 371
Right 1043578579 8:81686410-81686432 CTGCGAGCCTCTGCCAGGCCGGG 0: 1
1: 1
2: 1
3: 40
4: 311
1043578569_1043578589 25 Left 1043578569 8:81686391-81686413 CCCCGCCCCGAGCTGCGCCCTGC 0: 1
1: 1
2: 0
3: 43
4: 371
Right 1043578589 8:81686439-81686461 CCTGACCCGCGCTGGAGCATGGG 0: 1
1: 0
2: 0
3: 6
4: 94
1043578569_1043578580 0 Left 1043578569 8:81686391-81686413 CCCCGCCCCGAGCTGCGCCCTGC 0: 1
1: 1
2: 0
3: 43
4: 371
Right 1043578580 8:81686414-81686436 GAGCCTCTGCCAGGCCGGGCCGG 0: 1
1: 0
2: 3
3: 32
4: 341
1043578569_1043578585 17 Left 1043578569 8:81686391-81686413 CCCCGCCCCGAGCTGCGCCCTGC 0: 1
1: 1
2: 0
3: 43
4: 371
Right 1043578585 8:81686431-81686453 GGCCGGGTCCTGACCCGCGCTGG 0: 1
1: 0
2: 1
3: 8
4: 118
1043578569_1043578581 1 Left 1043578569 8:81686391-81686413 CCCCGCCCCGAGCTGCGCCCTGC 0: 1
1: 1
2: 0
3: 43
4: 371
Right 1043578581 8:81686415-81686437 AGCCTCTGCCAGGCCGGGCCGGG 0: 1
1: 0
2: 4
3: 79
4: 546
1043578569_1043578578 -5 Left 1043578569 8:81686391-81686413 CCCCGCCCCGAGCTGCGCCCTGC 0: 1
1: 1
2: 0
3: 43
4: 371
Right 1043578578 8:81686409-81686431 CCTGCGAGCCTCTGCCAGGCCGG 0: 1
1: 0
2: 1
3: 26
4: 291
1043578569_1043578575 -9 Left 1043578569 8:81686391-81686413 CCCCGCCCCGAGCTGCGCCCTGC 0: 1
1: 1
2: 0
3: 43
4: 371
Right 1043578575 8:81686405-81686427 GCGCCCTGCGAGCCTCTGCCAGG 0: 1
1: 0
2: 0
3: 20
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043578569 Original CRISPR GCAGGGCGCAGCTCGGGGCG GGG (reversed) Intronic