ID: 1043587385

View in Genome Browser
Species Human (GRCh38)
Location 8:81784770-81784792
Sequence AGGAGGTTACAGGTGCTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043587376_1043587385 5 Left 1043587376 8:81784742-81784764 CCCAAGGTGGTAAGTGGTCCACC No data
Right 1043587385 8:81784770-81784792 AGGAGGTTACAGGTGCTACAGGG No data
1043587377_1043587385 4 Left 1043587377 8:81784743-81784765 CCAAGGTGGTAAGTGGTCCACCA No data
Right 1043587385 8:81784770-81784792 AGGAGGTTACAGGTGCTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043587385 Original CRISPR AGGAGGTTACAGGTGCTACA GGG Intergenic
No off target data available for this crispr