ID: 1043593394

View in Genome Browser
Species Human (GRCh38)
Location 8:81855947-81855969
Sequence CACTGTGCACAGATGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043593394_1043593399 -1 Left 1043593394 8:81855947-81855969 CCATGTTTCATCTGTGCACAGTG No data
Right 1043593399 8:81855969-81855991 GGAAGTGGGCATGTTGCAAAGGG No data
1043593394_1043593401 27 Left 1043593394 8:81855947-81855969 CCATGTTTCATCTGTGCACAGTG No data
Right 1043593401 8:81855997-81856019 CCTCTGACCCTTTTGTTACTTGG No data
1043593394_1043593402 28 Left 1043593394 8:81855947-81855969 CCATGTTTCATCTGTGCACAGTG No data
Right 1043593402 8:81855998-81856020 CTCTGACCCTTTTGTTACTTGGG No data
1043593394_1043593398 -2 Left 1043593394 8:81855947-81855969 CCATGTTTCATCTGTGCACAGTG No data
Right 1043593398 8:81855968-81855990 TGGAAGTGGGCATGTTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043593394 Original CRISPR CACTGTGCACAGATGAAACA TGG (reversed) Intergenic
No off target data available for this crispr