ID: 1043601263

View in Genome Browser
Species Human (GRCh38)
Location 8:81941175-81941197
Sequence CCAGATTCAATCTTTGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043601263_1043601270 12 Left 1043601263 8:81941175-81941197 CCTCACTCAAAGATTGAATCTGG No data
Right 1043601270 8:81941210-81941232 CACATTCACCTTGCAGCCTAGGG No data
1043601263_1043601269 11 Left 1043601263 8:81941175-81941197 CCTCACTCAAAGATTGAATCTGG No data
Right 1043601269 8:81941209-81941231 CCACATTCACCTTGCAGCCTAGG No data
1043601263_1043601276 30 Left 1043601263 8:81941175-81941197 CCTCACTCAAAGATTGAATCTGG No data
Right 1043601276 8:81941228-81941250 TAGGGTACAGGAGTAAGTAGGGG No data
1043601263_1043601275 29 Left 1043601263 8:81941175-81941197 CCTCACTCAAAGATTGAATCTGG No data
Right 1043601275 8:81941227-81941249 CTAGGGTACAGGAGTAAGTAGGG No data
1043601263_1043601274 28 Left 1043601263 8:81941175-81941197 CCTCACTCAAAGATTGAATCTGG No data
Right 1043601274 8:81941226-81941248 CCTAGGGTACAGGAGTAAGTAGG No data
1043601263_1043601271 18 Left 1043601263 8:81941175-81941197 CCTCACTCAAAGATTGAATCTGG No data
Right 1043601271 8:81941216-81941238 CACCTTGCAGCCTAGGGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043601263 Original CRISPR CCAGATTCAATCTTTGAGTG AGG (reversed) Intergenic