ID: 1043601265

View in Genome Browser
Species Human (GRCh38)
Location 8:81941200-81941222
Sequence CAAGGTGAATGTGGTGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043601265_1043601274 3 Left 1043601265 8:81941200-81941222 CCACCACCACCACATTCACCTTG No data
Right 1043601274 8:81941226-81941248 CCTAGGGTACAGGAGTAAGTAGG No data
1043601265_1043601275 4 Left 1043601265 8:81941200-81941222 CCACCACCACCACATTCACCTTG No data
Right 1043601275 8:81941227-81941249 CTAGGGTACAGGAGTAAGTAGGG No data
1043601265_1043601278 7 Left 1043601265 8:81941200-81941222 CCACCACCACCACATTCACCTTG No data
Right 1043601278 8:81941230-81941252 GGGTACAGGAGTAAGTAGGGGGG 0: 1
1: 0
2: 0
3: 25
4: 181
1043601265_1043601276 5 Left 1043601265 8:81941200-81941222 CCACCACCACCACATTCACCTTG No data
Right 1043601276 8:81941228-81941250 TAGGGTACAGGAGTAAGTAGGGG No data
1043601265_1043601279 14 Left 1043601265 8:81941200-81941222 CCACCACCACCACATTCACCTTG No data
Right 1043601279 8:81941237-81941259 GGAGTAAGTAGGGGGGAAATAGG No data
1043601265_1043601271 -7 Left 1043601265 8:81941200-81941222 CCACCACCACCACATTCACCTTG No data
Right 1043601271 8:81941216-81941238 CACCTTGCAGCCTAGGGTACAGG No data
1043601265_1043601277 6 Left 1043601265 8:81941200-81941222 CCACCACCACCACATTCACCTTG No data
Right 1043601277 8:81941229-81941251 AGGGTACAGGAGTAAGTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043601265 Original CRISPR CAAGGTGAATGTGGTGGTGG TGG (reversed) Intergenic