ID: 1043601267

View in Genome Browser
Species Human (GRCh38)
Location 8:81941206-81941228
Sequence AGGCTGCAAGGTGAATGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043601267_1043601276 -1 Left 1043601267 8:81941206-81941228 CCACCACATTCACCTTGCAGCCT No data
Right 1043601276 8:81941228-81941250 TAGGGTACAGGAGTAAGTAGGGG No data
1043601267_1043601279 8 Left 1043601267 8:81941206-81941228 CCACCACATTCACCTTGCAGCCT No data
Right 1043601279 8:81941237-81941259 GGAGTAAGTAGGGGGGAAATAGG No data
1043601267_1043601278 1 Left 1043601267 8:81941206-81941228 CCACCACATTCACCTTGCAGCCT No data
Right 1043601278 8:81941230-81941252 GGGTACAGGAGTAAGTAGGGGGG No data
1043601267_1043601275 -2 Left 1043601267 8:81941206-81941228 CCACCACATTCACCTTGCAGCCT No data
Right 1043601275 8:81941227-81941249 CTAGGGTACAGGAGTAAGTAGGG No data
1043601267_1043601277 0 Left 1043601267 8:81941206-81941228 CCACCACATTCACCTTGCAGCCT No data
Right 1043601277 8:81941229-81941251 AGGGTACAGGAGTAAGTAGGGGG No data
1043601267_1043601274 -3 Left 1043601267 8:81941206-81941228 CCACCACATTCACCTTGCAGCCT No data
Right 1043601274 8:81941226-81941248 CCTAGGGTACAGGAGTAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043601267 Original CRISPR AGGCTGCAAGGTGAATGTGG TGG (reversed) Intergenic