ID: 1043601269 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:81941209-81941231 |
Sequence | CCACATTCACCTTGCAGCCT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1043601263_1043601269 | 11 | Left | 1043601263 | 8:81941175-81941197 | CCTCACTCAAAGATTGAATCTGG | No data | ||
Right | 1043601269 | 8:81941209-81941231 | CCACATTCACCTTGCAGCCTAGG | No data | ||||
1043601262_1043601269 | 24 | Left | 1043601262 | 8:81941162-81941184 | CCTAGTGTAGTGTCCTCACTCAA | No data | ||
Right | 1043601269 | 8:81941209-81941231 | CCACATTCACCTTGCAGCCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1043601269 | Original CRISPR | CCACATTCACCTTGCAGCCT AGG | Intergenic | ||