ID: 1043601274

View in Genome Browser
Species Human (GRCh38)
Location 8:81941226-81941248
Sequence CCTAGGGTACAGGAGTAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043601266_1043601274 0 Left 1043601266 8:81941203-81941225 CCACCACCACATTCACCTTGCAG No data
Right 1043601274 8:81941226-81941248 CCTAGGGTACAGGAGTAAGTAGG No data
1043601263_1043601274 28 Left 1043601263 8:81941175-81941197 CCTCACTCAAAGATTGAATCTGG No data
Right 1043601274 8:81941226-81941248 CCTAGGGTACAGGAGTAAGTAGG No data
1043601265_1043601274 3 Left 1043601265 8:81941200-81941222 CCACCACCACCACATTCACCTTG No data
Right 1043601274 8:81941226-81941248 CCTAGGGTACAGGAGTAAGTAGG No data
1043601267_1043601274 -3 Left 1043601267 8:81941206-81941228 CCACCACATTCACCTTGCAGCCT No data
Right 1043601274 8:81941226-81941248 CCTAGGGTACAGGAGTAAGTAGG No data
1043601268_1043601274 -6 Left 1043601268 8:81941209-81941231 CCACATTCACCTTGCAGCCTAGG No data
Right 1043601274 8:81941226-81941248 CCTAGGGTACAGGAGTAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043601274 Original CRISPR CCTAGGGTACAGGAGTAAGT AGG Intergenic