ID: 1043601275

View in Genome Browser
Species Human (GRCh38)
Location 8:81941227-81941249
Sequence CTAGGGTACAGGAGTAAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043601266_1043601275 1 Left 1043601266 8:81941203-81941225 CCACCACCACATTCACCTTGCAG No data
Right 1043601275 8:81941227-81941249 CTAGGGTACAGGAGTAAGTAGGG No data
1043601263_1043601275 29 Left 1043601263 8:81941175-81941197 CCTCACTCAAAGATTGAATCTGG No data
Right 1043601275 8:81941227-81941249 CTAGGGTACAGGAGTAAGTAGGG No data
1043601265_1043601275 4 Left 1043601265 8:81941200-81941222 CCACCACCACCACATTCACCTTG No data
Right 1043601275 8:81941227-81941249 CTAGGGTACAGGAGTAAGTAGGG No data
1043601268_1043601275 -5 Left 1043601268 8:81941209-81941231 CCACATTCACCTTGCAGCCTAGG No data
Right 1043601275 8:81941227-81941249 CTAGGGTACAGGAGTAAGTAGGG No data
1043601267_1043601275 -2 Left 1043601267 8:81941206-81941228 CCACCACATTCACCTTGCAGCCT No data
Right 1043601275 8:81941227-81941249 CTAGGGTACAGGAGTAAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043601275 Original CRISPR CTAGGGTACAGGAGTAAGTA GGG Intergenic