ID: 1043601279

View in Genome Browser
Species Human (GRCh38)
Location 8:81941237-81941259
Sequence GGAGTAAGTAGGGGGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043601272_1043601279 -4 Left 1043601272 8:81941218-81941240 CCTTGCAGCCTAGGGTACAGGAG No data
Right 1043601279 8:81941237-81941259 GGAGTAAGTAGGGGGGAAATAGG No data
1043601265_1043601279 14 Left 1043601265 8:81941200-81941222 CCACCACCACCACATTCACCTTG No data
Right 1043601279 8:81941237-81941259 GGAGTAAGTAGGGGGGAAATAGG No data
1043601267_1043601279 8 Left 1043601267 8:81941206-81941228 CCACCACATTCACCTTGCAGCCT No data
Right 1043601279 8:81941237-81941259 GGAGTAAGTAGGGGGGAAATAGG No data
1043601266_1043601279 11 Left 1043601266 8:81941203-81941225 CCACCACCACATTCACCTTGCAG No data
Right 1043601279 8:81941237-81941259 GGAGTAAGTAGGGGGGAAATAGG No data
1043601268_1043601279 5 Left 1043601268 8:81941209-81941231 CCACATTCACCTTGCAGCCTAGG No data
Right 1043601279 8:81941237-81941259 GGAGTAAGTAGGGGGGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043601279 Original CRISPR GGAGTAAGTAGGGGGGAAAT AGG Intergenic