ID: 1043603544

View in Genome Browser
Species Human (GRCh38)
Location 8:81971329-81971351
Sequence TGGCAAACAGCAGTGGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043603537_1043603544 -1 Left 1043603537 8:81971307-81971329 CCACACAGTCGGCATTTCAATAT No data
Right 1043603544 8:81971329-81971351 TGGCAAACAGCAGTGGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043603544 Original CRISPR TGGCAAACAGCAGTGGGGGT GGG Intergenic
No off target data available for this crispr