ID: 1043603980

View in Genome Browser
Species Human (GRCh38)
Location 8:81976901-81976923
Sequence AACTATCTCCAGTTTAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043603980_1043603983 -7 Left 1043603980 8:81976901-81976923 CCTTCCTTAAACTGGAGATAGTT No data
Right 1043603983 8:81976917-81976939 GATAGTTCTTAAATCAGAGGTGG No data
1043603980_1043603982 -10 Left 1043603980 8:81976901-81976923 CCTTCCTTAAACTGGAGATAGTT No data
Right 1043603982 8:81976914-81976936 GGAGATAGTTCTTAAATCAGAGG No data
1043603980_1043603985 7 Left 1043603980 8:81976901-81976923 CCTTCCTTAAACTGGAGATAGTT No data
Right 1043603985 8:81976931-81976953 CAGAGGTGGATGGAATGTTAAGG No data
1043603980_1043603984 -3 Left 1043603980 8:81976901-81976923 CCTTCCTTAAACTGGAGATAGTT No data
Right 1043603984 8:81976921-81976943 GTTCTTAAATCAGAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043603980 Original CRISPR AACTATCTCCAGTTTAAGGA AGG (reversed) Intergenic