ID: 1043603983

View in Genome Browser
Species Human (GRCh38)
Location 8:81976917-81976939
Sequence GATAGTTCTTAAATCAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043603976_1043603983 21 Left 1043603976 8:81976873-81976895 CCTAACAATATCAACCACTGTAC No data
Right 1043603983 8:81976917-81976939 GATAGTTCTTAAATCAGAGGTGG No data
1043603980_1043603983 -7 Left 1043603980 8:81976901-81976923 CCTTCCTTAAACTGGAGATAGTT No data
Right 1043603983 8:81976917-81976939 GATAGTTCTTAAATCAGAGGTGG No data
1043603978_1043603983 7 Left 1043603978 8:81976887-81976909 CCACTGTACTAGGACCTTCCTTA No data
Right 1043603983 8:81976917-81976939 GATAGTTCTTAAATCAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043603983 Original CRISPR GATAGTTCTTAAATCAGAGG TGG Intergenic