ID: 1043603984

View in Genome Browser
Species Human (GRCh38)
Location 8:81976921-81976943
Sequence GTTCTTAAATCAGAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043603978_1043603984 11 Left 1043603978 8:81976887-81976909 CCACTGTACTAGGACCTTCCTTA No data
Right 1043603984 8:81976921-81976943 GTTCTTAAATCAGAGGTGGATGG No data
1043603976_1043603984 25 Left 1043603976 8:81976873-81976895 CCTAACAATATCAACCACTGTAC No data
Right 1043603984 8:81976921-81976943 GTTCTTAAATCAGAGGTGGATGG No data
1043603981_1043603984 -7 Left 1043603981 8:81976905-81976927 CCTTAAACTGGAGATAGTTCTTA No data
Right 1043603984 8:81976921-81976943 GTTCTTAAATCAGAGGTGGATGG No data
1043603980_1043603984 -3 Left 1043603980 8:81976901-81976923 CCTTCCTTAAACTGGAGATAGTT No data
Right 1043603984 8:81976921-81976943 GTTCTTAAATCAGAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043603984 Original CRISPR GTTCTTAAATCAGAGGTGGA TGG Intergenic