ID: 1043606557

View in Genome Browser
Species Human (GRCh38)
Location 8:82007836-82007858
Sequence CAATCACCTGCTACTTTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043606557_1043606560 6 Left 1043606557 8:82007836-82007858 CCTCTGAAAGTAGCAGGTGATTG No data
Right 1043606560 8:82007865-82007887 TTCCTCACCACTTGCAGCCCTGG No data
1043606557_1043606567 28 Left 1043606557 8:82007836-82007858 CCTCTGAAAGTAGCAGGTGATTG No data
Right 1043606567 8:82007887-82007909 GGCCTCAGAGAGAGAGACATGGG No data
1043606557_1043606561 7 Left 1043606557 8:82007836-82007858 CCTCTGAAAGTAGCAGGTGATTG No data
Right 1043606561 8:82007866-82007888 TCCTCACCACTTGCAGCCCTGGG No data
1043606557_1043606566 27 Left 1043606557 8:82007836-82007858 CCTCTGAAAGTAGCAGGTGATTG No data
Right 1043606566 8:82007886-82007908 GGGCCTCAGAGAGAGAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043606557 Original CRISPR CAATCACCTGCTACTTTCAG AGG (reversed) Intergenic
No off target data available for this crispr