ID: 1043607480

View in Genome Browser
Species Human (GRCh38)
Location 8:82019755-82019777
Sequence ATGTCTTTATAGCAGTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043607476_1043607480 10 Left 1043607476 8:82019722-82019744 CCTATTTTCTTTATAAATTACCC 0: 161
1: 4482
2: 10156
3: 9131
4: 5544
Right 1043607480 8:82019755-82019777 ATGTCTTTATAGCAGTGTGAAGG No data
1043607478_1043607480 -10 Left 1043607478 8:82019742-82019764 CCCAGTCTCAGGTATGTCTTTAT 0: 2779
1: 6067
2: 10377
3: 11010
4: 9585
Right 1043607480 8:82019755-82019777 ATGTCTTTATAGCAGTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043607480 Original CRISPR ATGTCTTTATAGCAGTGTGA AGG Intergenic
No off target data available for this crispr