ID: 1043611973

View in Genome Browser
Species Human (GRCh38)
Location 8:82076150-82076172
Sequence CCATATACAAAATGGCCAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043611973_1043611980 23 Left 1043611973 8:82076150-82076172 CCTATTGGCCATTTTGTATATGG No data
Right 1043611980 8:82076196-82076218 AATTTTTATTTATTATAAATGGG No data
1043611973_1043611977 -2 Left 1043611973 8:82076150-82076172 CCTATTGGCCATTTTGTATATGG No data
Right 1043611977 8:82076171-82076193 GGTCAATTGTACCTGGTAAATGG No data
1043611973_1043611979 22 Left 1043611973 8:82076150-82076172 CCTATTGGCCATTTTGTATATGG No data
Right 1043611979 8:82076195-82076217 TAATTTTTATTTATTATAAATGG No data
1043611973_1043611976 -9 Left 1043611973 8:82076150-82076172 CCTATTGGCCATTTTGTATATGG No data
Right 1043611976 8:82076164-82076186 TGTATATGGTCAATTGTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043611973 Original CRISPR CCATATACAAAATGGCCAAT AGG (reversed) Intergenic
No off target data available for this crispr