ID: 1043611976

View in Genome Browser
Species Human (GRCh38)
Location 8:82076164-82076186
Sequence TGTATATGGTCAATTGTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043611973_1043611976 -9 Left 1043611973 8:82076150-82076172 CCTATTGGCCATTTTGTATATGG No data
Right 1043611976 8:82076164-82076186 TGTATATGGTCAATTGTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043611976 Original CRISPR TGTATATGGTCAATTGTACC TGG Intergenic
No off target data available for this crispr